Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Plant Biology

Open Access

Genetic mapping of a new race specific resistance allele effective to Puccinia hordei at the Rph9/Rph12locus on chromosome 5HL in barley

  • Peter M Dracatos1Email author,
  • Mehar S Khatkar2,
  • Davinder Singh1 and
  • Robert F Park1
BMC Plant Biology201414:1598

https://doi.org/10.1186/s12870-014-0382-4

Received: 26 July 2014

Accepted: 12 December 2014

Published: 20 December 2014

Abstract

Background

Barley is an important cereal crop cultivated for malt and ruminant feed and in certain regions it is used for human consumption. It is vulnerable to numerous foliar diseases including barley leaf rust caused by the pathogen Puccinia hordei.

Results

A temporarily designated resistance locus RphCantala (RphC) identified in the Australian Hordeum vulgare L. cultivar ‘Cantala’ displayed an intermediate to low infection type (“;12 = N”) against the P. hordei pathotype 253P- (virulent on Rph1, Rph2, Rph4, Rph6, Rph8 and RphQ). Phenotypic assessment of a ‘CI 9214’ (susceptible) x ‘Stirling’ (RphC) (CI 9214/Stirling) doubled haploid (DH) population at the seedling stage using P. hordei pathotype 253P-, confirmed that RphC was monogenically inherited. Marker-trait association analysis of RphC in the CI 9214/Stirling DH population using 4,500 DArT-seq markers identified a highly significant (−log10Pvalue > 17) single peak on the long arm of chromosome 5H (5HL). Further tests of allelism determined that RphC was genetically independent of Rph3, Rph7, Rph11, Rph13 and Rph14, and was an allele of Rph12 (Rph9.z), which also maps to 5HL.

Conclusion

Multipathotype tests and subsequent pedigree analysis determined that 14 related Australian barley varieties (including ‘Stirling’ and ‘Cantala’) carry RphC and that the likely source of this resistance is via a Czechoslovakian landrace LV-Kvasice-NA-Morave transferred through common ancestral cultivars ‘Hanna’ and ‘Abed Binder’. RphC is an allele of Rph12 (Rph9.z) and is therefore designated Rph9.am. Bioinformatic analysis using sequence arrays from DArT-seq markers in linkage disequilibrium with Rph9.am identified possible candidates for further gene cloning efforts and marker development at the Rph9/Rph12/Rph9.am locus.

Keywords

ResistancePuccinia hordeiGenetic mapping

Background

Leaf rust, caused by Puccinia hordei, is one of the most destructive foliar diseases of barley, and has caused significant yield losses in many regions where barley is grown [1]-[3]. Yield reductions of up to 32% have been reported in certain susceptible barley cultivars in both Australia and North America [4]. Due to potentially adverse environmental effects of fungicides, the most preferable and cost-effective means of controlling barley leaf rust is through the development and deployment of durable host resistance [5].

In cereals, two major types of resistance have been described for rust pathogens, seedling resistance and adult plant resistance (APR). Seedling resistance genes are effective at all stages of crop development and are often characterized by a hypersensitive response. Numerous genes conferring seedling resistance to P. hordei (Rph) have been identified (Rph1-Rph19 [6], Rph21-Rph22 [7],[8]), however, virulence matching most of these genes has been detected [9]. In some regions, including South Australia, the presence of the alternate host Ornithogalum umbellatum (‘Star of Bethlehem’) can permit sexual recombination and increase the likelihood of new virulent pathotypes developing [9]-[12]. New sources of seedling resistance are required for use in breeding programs in combination with APR for durable protection against P. hordei. Furthermore, for effective deployment within breeding programs, it is equally important to understand the mechanisms of inheritance and pathotype specificity of newly identified resistance genes.

Previous studies on the inheritance of seedling resistance to P. hordei have determined that many of the known Rph loci are complex. From a total of 23 catalogued Rph genes, three have been previously reported to be alleles of other genes. Rph5 is allelic to Rph6 [13], Rph12 is allelic to Rph9 [14] and Rph15 is allelic to Rph16 [15]. In the case of Rph9 and Rph12, a large F2 population of 3,858 progeny derived from ‘HOR 2596’ (Rph9) x ‘Triumph’ (Rph12) was evaluated and no recombinants were detected, suggesting that both are alleles of the same gene [14]. Rph9 and Rph12 also mapped to the same locus on chromosome 5H and were linked to a common molecular marker, ABC155. Previous studies have determined that the Australian cultivar ‘Cantala’ carries an uncharacterised seedling gene for resistance to P. hordei that was temporarily designated RphCantala (RphC) [1]. Recent evidence suggests the RphC is present in several Australian and European barley cultivars and was originally derived from European descent. Although virulence for RphC is common among Australian populations of P. hordei, such resistance may be useful in combination with other resistance sources. This study reports on the characterization and genetic mapping of the RphC resistance. Data on both the physical location and possible candidate genes for the RphC resistance locus are presented and discussed.

Methods

Plant and pathogen material

A doubled haploid (DH) population, CI 9214/Stirling, derived from ‘CI 9214’ (PI 186125) (postulated to carry Rph1; R. F. Park, unpublished) and ‘Stirling’ (PI 466919) (RphCantala; [1], R. F. Park, unpublished) with 258 progeny was used for genetic analysis in this study. F3 populations derived by intercrossing ‘Cantala’ (PI 483047) with ‘Estate’ (Rph3) (CI 3410), ‘Cebada Capa’ (CI 6193) (Rph7), ‘Clipper BC8’ (Rph10), ‘Triumph’ (Rph12) (PI 186125), and PI 531849’ (Rph13) were used for tests of allelism. A total of five pathotypes of P. hordei used in the study along with their virulence/avirulence profiles and reactions to barley differential lines and Australian cultivars postulated to carry RphC are listed in Table 1. All pathotypes used originated from annual pathogenicity surveys of P. hordei conducted in Australia and are maintained in liquid nitrogen at the Plant Breeding Institute, University of Sydney.
Table 1

Seedling response of selected barley genotypes to five Australian pathotypes of Puccinia hordei

  

Pathotype [accession number 1]

Cultivar

Resistance gene

200P- 2[S3088 3]

200P+ [900233]

243P- [920636]

253P- [760462]

4610P+ [900380]

Sudan

Rph1

;1 N

;1 N

3+

3+

;1 N

Peruvian

Rph2

;12 = C

;12 = CN

3+

33+

;12 = CN

Estate

Rph3

;

;

;

;

;

Gold

Rph4

;12-

;1 + N

;12-

3+

3+

Magnif 104

Rph5

;N

;1 N

;N

;N

;N

Bolivia

Rph2 + Rph6

;12 = C

;12 = CN

33 + C

33+

;12 = CN

Cebada Capa

Rph7

0;N

0;N

0;N

0;N

0;N

Egypt 4

Rph8

33+

33+

3+

3+

3+

Abyssinian

Rph9

;12 = C

;2 = C

;12 = C

;1-CN

3+

Clipper

-

3+

3+

3+

3+

3+

Clipper BC8

Rph10

3+

;1CN

;1 + N

2++3

2++3

Clipper BC67

Rph11

12-N

12+

22+

22-C

2-C

Triumph

Rph12

12 = N

12 = N

22+

12 = N

3+

PI 531849

Rph13

;N

;-N

;N

;N

;N

PI 584760

Rph14

;12-C

;12-C

2+

2+

22 + C

Bowman*4/PI355447

Rph15

;N

;N

;N

;N

;N

Q21861

RphQ

;1 N

;1 N

3+

3+

;12 = N

38P184

Rph18

;-N

;-N

;-N

;-N

;-N

Reka 1

Rph2 + Rph19

;N

;1 + CN

;12-N

;1 N

;12 = N

Prior

Rph19

;1 N

3+

;1-N

;N

3+

Ricardo

Rph2 + Rph21

;12-N

;12-N

2 + 2++

2++

12 = N

Cantala

RphCantala

3+

3+

3+

;12 = CN

3+

Bandulla

RphCantala

3+

3+

3+

;12 = CN

3+

Bussell

RphCantala

3+

3+

3+

;12 = N

3+

Chebec

RphCantala + Rph19

12-C

3+

12-CN

;12 = CN

3+

Hannan

RphCantala

3+

3+

3+

;12 = CN

3+

Lara

RphCantala

3+

3+

3+

;12 = N

3+

Milby

RphCantala

3+

3+

3+

;12 = N

3+

Moondyne

RphCantala

3+

3+

3+

;12 = N

3+

Noyep

RphCantala

3+

3+

3+

;12 = N

3+

Parwan

RphCantala

3+

3+

3+

;12 = N

3+

Research

RphCantala

3+

3+

3+

;12 = N

3+

Resibee

RphCantala

3+

3+

3+

;12 = N

3+

Tilga

RphCantala

3+

3+

3+

;12 = N, 3+

3+

Stirling

RphCantala

3+

3+

3+

;12 = N

3+

1Plant Breeding Institute Cobbitty rust collection accession numbers.

2P- and P+ indicate avirulence and virulence, respectively, for Rph19.

3Culture kindly provided by Dr R.G. Rees, Queensland Department of Primary Industries.

4Original seed kindly supplied by Dr R.A. Pickering, New Zealand Institute for Crop and Food Research Limited.

Sowing, inoculation and disease assessment procedures

Sowing and inoculations were performed as described by Sandhu et al. [6]. Disease response was assessed 12 days after inoculation using a modified “0” – “4” scale as described by McIntosh et al. [16]. Variations of the infection types were indicated by the use of “-” (less than average for the class), ‘+’ (more than average for the class), ‘C’ (chlorosis), ‘N’ (necrosis) and “X” which denotes a mesothetic infection type with a mixture of infection types on the same leaf. A comma separating different infection types was used to indicate heterogeneity within a given test host genotype. When two different infection types were observed on a single leaf, they were written together without a comma.

Genetic mapping of RphCin the CI 9214/Stirling DH population

Genomic DNA was extracted from the leaf tissues of a single plant from a subset of 61 from the 258 original CI 9214/Stirling DH lines using CTAB essentially as described by Fulton et al. [17]. The DNA of each DH line was diluted to 100 ngμL−1 and subjected to genotypic analysis using the DArT-seq platform essentially as described by Curtois et al. [18], except that the marker curation involved removing the markers with low minor allelic frequency (MAF) (i.e. < 0.1) and > 50% missing data.

Genetic linkage maps were constructed using MSTMap software [19]. The following specific parameters of MSTMap were used viz. name for the mapping population: DH; the distance function: Kosambi; the threshold to be used for clustering the markers into LGs: 0.000001; the objective function: COUNT. In addition, any group of markers less than two and with a distance of 15 centimorgans (cM) away from the rest of the markers was placed in a separate linkage group. This linkage map of the CI 9214/Stirling DH population was specifically constructed for genetic mapping of RphC, for this the phenotypic data of P. hordei pathotype 253P- was converted to binary data [(susceptible 3+ =0 or resistant i.e. ;12 = CN” =1) and was then included as an additional marker. The map positions (cM) of all closely linked DArT-seq markers to RphC on the CI 9214/Stirling genetic map were compared with the Bowman consensus map and the Hordeum vulgare L. cv. ‘Bowman’ genome assembly [20].

Marker-trait and bioinformatic analysis of closely linked DArT markers at the RphClocus

Marker-trait analysis of each DArT marker with the RphC phenotype was conducted by computing Fisher’s exact test on 2 X 2 count tables using R statistical software (www.r-project.org). The null hypothesis was that the DArT marker genotypes were not associated with resistance to P. hordei; hence a random distribution of genotypes in the resistant and susceptible phenotypic groups. The –log10 of P values were plotted against the positions on the physical Bowman genome assembly [20] by means of chromosome-wise and genome-wide ‘Manhattan’ plots.

Linkage disequilibrium (LD) r 2 was measured between the binary scores of the RphC phenotype (0, 1) with each DArT-seq marker genotype using GOLD [21]. The correlation coefficient of each marker with RphC binary phenotypic score was plotted against the Bowman genome assembly by means of a genome-wide ‘Manhattan’ plot. The sequences of DArT-seq markers with r 2  > 0.8 were individually blasted (blastn) against the ‘Morex’ barley genome sequence browser (www.gramene.org) to identify the physical scaffold of genes in the region between markers flanking RphC based on relationships between the CI 9214/Stirling DH population genetic map and the 'Bowman' consensus genetic maps. The physical positions and annotations of all genes located between DArT-seq marker DART461 (504808312–504808380) and DART4872 (509749584–509749620) were tabulated to identify possible candidates for RphC. Further Pfam protein annotations were also assigned to the DArT-seq markers that were located within predicted genes in the ‘Morex’ genome. The haplotype blocks in the significant region were constructed using Haploview [22] to examine the LD in the region and among significant DArT-seq markers.

Results

Multipathotype tests

The barley cultivar ‘Cantala’ contained an uncharacterised seedling resistance gene (RphC) to P. hordei that was identified through phenotypic assessment of the Australian barley differential lines (including ‘Cantala’) with a range of P. hordei pathotypes (Table 1). Multi-pathotyping tests on other barley cultivars suggested that that in addition to ‘Cantala’ , ‘Bandulla’ , ‘Bussell’ , ‘Chebec’ (with Rph19), ‘Hamelin’ , ‘Lara’ , ‘Milby’ , ‘Moondyne’ , ‘Noyep’ , ‘Parwan’ , ‘Research’ , ‘Resibee’ , ‘Tilga’ (heterogeneous) and ‘Stirling’ also carry RphC. None of these cultivars carried Rph12 (Table 1).

Genetic analyses of DH population CI 9214/Stirling

The parental genotypes of the CI 9214/Stirling DH population were postulated to carry Rph1 and RphC based on the observed infection types (IT) in response to P. hordei pathotypes 200P- (avirulent for Rph1 and virulent for RphC) and 253P- (virulent for Rph1 and avirulent for RphC), respectively (Figure 1; Table 1). Pathotype 200P- was avirulent on ‘CI 9214’ (Rph1) and ‘Triumph’ (Rph12) and virulent on ‘Cantala’ (RphC). Conversely, pathotype 253P- was virulent on ‘CI 9214’ (Rph1) and avirulent on ‘Stirling’ (RphC), ‘Cantala’ (RphC) and ‘Triumph’ (Rph12). Both pathotypes were virulent on the universal susceptible line ‘Gus’ (Figure 1; Table 1). The CI 9214/Stirling population of 258 DH lines was phenotyped using pathotype 253P- and in response the resistant parent ‘Stirling’ gave the same IT “;12 = CN” as observed in the barley variety ‘Cantala’ with the same pathotype, whilst the susceptible parent ‘CI 9214’ gave IT “3+” to this pathotype. The observed segregation within the CI 9214/Stirling population fitted with a predicted single gene inheritance model 1:1 ratio using Chi squared analysis (121 resistant: 137 susceptible (P > 0.3)).
Figure 1

Seedling leaves of the infection types of (L to R): (1) CI9214 ( P. hordei pathotype [pt] 253P-/Virulent Rph1 ) (2) CI9214 (pt 210P+/avr Rph1 ) (3) Stirling (pt 253P-/avr RphCantala ) (4) Cantala (pt 253P-/avr RphCantala ) (5) Cantala (pt 210P+/vir RphCantala ) (6) Triumph (pt 253P-/avr Rph12 ) (7) Gus (pt 253P-/vir) and (8) Gus (pt 210P+/vir).

Genetic mapping of RphC

A total of 61 representative genotypes of the CI 9214/Stirling DH population from both resistant and susceptible phenotypic classes were selected for genetic mapping of RphC and subsequently genotyped using 10,258 DArT-seq marker loci. A genetic map was constructed and contained nine linkage groups spanning 4,246 cM using over 4,500 DArT-seq markers, which include the RphC binary phenotype as a marker. Based on the known positions of flanking markers on the consensus ‘Bowman’ , ‘Morex’ and ‘Barke’ genetic maps, RphC was mapped to chromosome 5HL between 129–134 cM (Figure 2). RphC co-segregated with two DArT markers (DART4872 and DART7508) and was 1.8 cM distal to the flanking markers DART2682, DART5867 and DART7413 and 3.9 cM proximal to DART6236 and DART214 (Figure 2). Further genome-wide marker-trait association demonstrated that DArT sequences only on 5HL were associated with RphC phenotypic scores indicated by two significant peaks [−log10(P-value) of 17.5], across the entire genome, at approximately 506 Mb on 5HL (Figures 3A and 3B) and correlated with LD mapping results of RphC (Additional file 1). Further linkage disequilibrium analysis identified that the 2nd peak at 430 Mb was due to incorrect map position of a single DArT marker (data not shown).
Figure 2

Partial linkage maps of linkage group seven of nine of the CI9214/Stirling doubled haploid population encompassing leaf rust resistance gene RphCantala . Comparative map analysis was performed using common DArT markers between the CI9214/Stirling and the 'Bowman' consensus DArT-seq genetic map. DArT markers in common are in bold.

Figure 3

Marker trait association analysis scans using Fisher’s exact test Vertical axis represents -log10 (P) values of the P-value of the marker trait association. The peaks above minimum threshold of 2 (P-value = 0.03) can be considered as significantly associated. The colours blue and red were used to differentiate between chromosomes (1H-7H). (A) Chromosome-wise plot and (B) genome-wide manhattan plot of chromosome 5HL derived from marker-trait association (MTA) analysis using Fisher’s exact test on 2 X 2 count table for seedling resistance to Puccinia hordei pathotype 253P- (binary scoring data) in the CI9214/Stirling doubled haploid population using 4, 500 DArT-seq markers. The –log10 of P-values were plotted against the positions on the physical Bowman genome assembly [20]. The peaks above minimum threshold of 2 (P-value = 0.03) can be considered as significantly associated.

Tests of allelism

Tests of allelism between RphC and two previously identified Rph seedling genes on chromosome 5HL (Rph12 and Rph13) indicated that RphC is independent of Rph13 but completely linked with Rph12. A two-gene segregation (fitting 7Res: 8Seg: 1Sus model) was observed in F3 families involving crosses of RphC with Rph13 when tested with pathotype 253P- (Table 2). On other hand, there was no segregation among F3 families of cross involving RphC and Rph12 when tested with pathotype 253P- (avirulent for both RphC and Rph12). This suggests that RphC is an allele of Rph12 (Rph9.z) with distinct specificity and can therefore be given the allele designation Rph9.am. Two additional populations derived from ‘Estate’ (Rph3)/Cantala’ and ‘Cebada Capa’ (Rph7)/‘Cantala’ were also tested with pathotype 253P- and both populations conformed to expected two gene segregation model (Table 2).
Table 2

Chi squared analysis of barley populations for tests for allelism with RphCantala

Population

Genes involved

Pop

No. of F 3families

Genetic ratio

P value

Chi square

   

NSR

Seg

NSS

   

Cantala/Triumph

RphC/Rph12

F3

208

  

No segregation#

<0.0001

267.429a

Cantala/PI531849

RphC/Rph13

F3

69

71

10

7:8:1

0.807

0.429a

Cantala/Estate

RphC/Rph3

F3

112

87

18

7:8:1

0.012

8.779a

Cantala/Cebada Capa

RphC/Rph7

F3

72

107

8

7:8:1

0.117

4.290a

Stirling/CI9214

RphC/Rph1

DH

121

 

137

1:1

0.319

0.992b

Maximum recombination r = 1.1 cM (P = 0.01) and r = 0.7 cM (P = 0.05) calculated from Hanson [32] based on the hypothesis that the two loci are different.

#Chi squared values are denoted a and b for 2 and 1 degrees of freedom, respectively.

Pedigree analysis for RphCresistance

Pedigree analysis was performed on all 14 Australian barley cultivars postulated to carry RphC including: ‘Bandulla’ , ‘Bussell’ , ‘Cantala’ , ‘Chebec’ , ‘Hamelin’ , ‘Lara’ , ‘Milby’ , ‘Moondyne’ , ‘Noyep’ , ‘Parwan’ , ‘Research’ , ‘Resibee’ , ‘Tilga’ (heterogeneous) and ‘Stirling’ using the online barley pedigree resource http://genbank.vurv.cz/barley/pedigree/. On this basis, cultivars ‘Gull’ and ‘Binder’ were predicted to be the sources of the RphC resistance in ‘Stirling’ , ‘Bandulla’ , ‘Noyep’ , ‘Lara’ , ‘Stirling’ , ‘Research’ , ‘Chebec’ , ‘Moondyne’ , ‘Bussell’ and ‘Cantala’. Pedigree analysis suggests that ‘Maja’ (pedigree of ‘Ymer’ and ‘Erectoides 16’) share common ancestry of ‘Binder’ and ‘Gull’ (Figure 4). Both ‘Gull’ and ‘Binder’ were derived from landraces from Sweden (‘LV-Gotland’) and ‘Czechoslovakia’ (LV-Kvasice-NA-Morave through ‘Hanna’), respectively (Figure 4). The donor sources of seedling resistance in ‘Hannan’ , ‘Milby’ and ‘Tilga’ could not be explained based on available pedigree information.
Figure 4

Pedigree relationship of barley varieties ‘Stirling’ (PI 466919) and ‘Cantala’ (PI 483047/AUS 99074) (postulated to carry RphCantala based on multipathotype tests and genetic mapping analysis) tracing the RphC resistance back to Swedish and Czechoslovakian landraces LV-Gotland and LV-Kvasice-NA-Morave. ‘Cantala’ is derived from pedigrees ‘Kenia’ and ‘Erectoides 16’, a mutant derived from the Danish cultivar ‘Maja’.

LD and bioinformatic analysis of closely linked DArT markers at the RphClocus

A total of 15 DArT-seq markers had an r 2  > 0.8 and five of these were in complete LD (r 2  = 1) with RphC (Table 3; Figure 3; Additional file 1). Table 4 provides a list of DArT locus name, clone ID and associated sequences for each marker. DArT-seq markers DART4872 and DART7508 that co-located with RphC in the CI 9214/Stirling genetic map were both in complete LD with RphC, however, they along with DART7846 were not present in the ‘Bowman’ consensus maps (Table 3; Figure 2). Furthermore, the sequence of the most closely associated DArT-seq marker based on the lowest Fisher's exact test P value to RphC (DArT4851) was located within a predicted disease resistance protein (NB-ARC) based on Pfam analysis (Table 3). Two other sequences (DART7846 and DART3079) were located within the same transcript of another predicted disease resistance gene (serine/threonine receptor kinase gene) on chromosome 5HL. In the ‘Morex’ genome both DART7846 and DART3079 had a closest match to a physical position 9520434–9520483 distant to all other closely associated DArT sequences, but the contig in the ‘Bowman’ assembly mapped to physical position 506583400 (Table 3).
Table 3

Details of bioinformatic analyses of DArT-seq markers closely linked to RphCantala

DArT locus_name

r 2with RphCantala

Bowman cM

C/S cM

Fisher's P-value

Barley physical

Bowman physical

Blastn P-value

Morex physical

Pfam Morex 5HL

DART4851

1

131.67

97.30

1.69E-17

5HL

506583400

3.40E-27

506781405-506781469

NB-ARC

DART4872

1

NA

90.74

1.69E-17

5HL

NA

1.80E-11

509749584-509749620

No match

DART7507

1

NA

97.30

5.33E-16

5HL

NA

2.00E-16

506713993-506714061

Tubulin -GTPase

DART7846

1

NA

NA

3.93E-12

5HL

NA

1.30E-19

9520434-9520483

Serine/threonine Protein Kinase

DART3079

0.937

130.9

102.04

1.38E-16

5HL

506583400

5.80E-32

9519766-9519834

Serine/threonine Protein Kinase

DART3263

0.937

134.72

NA

1.38E-16

5HL

509518480

1.40E-29

509705303-509705371

No match

DART5481

0.918

134.72

89.13

1.05E-12

5HL

509518480

5.80E-32

506948877-506948945

Inosine-5′-monophosphate dehydrogenase

DART2133

0.875

129.72

103.65

4.13E-15

5HL

505380600

1.40E-29

505484624-505484692

No match

DART2681

0.873

130.9

102.04

4.13E-15

5HL

506583400

1.40E-29

506600697-506604765

No match

DART6198

0.873

129.44

110.31

4.13E-15

5HL

504740440

1.40E-29

504879962-504880030

Cytochrome P450

DART4228

0.867

129.72

103.64

1.52E-14

5HL

505380600

5.80E-32

505484082-505484150

No match

DART4182

0.867

129.83

110.307

5.60E-14

5HL

505380600

5.80E-32

505506713-505506781

AP2 transcription factor

DART5422

0.857

129.83

111.92

7.50E-13

5HL

505380600

1.40E-29

505507578-505507646

AP2 transcription factor

DART461

0.817

129.44

115.15

6.41E-14

5HL

504780440

5.80E-32

504808312-504808380

Uncharacterised protein

NA, not available.

Table 4

Summary information for significant DArT-seq markers in linkage disquilibrium (r2 > 0.8) with RphCantala on chromosome 5HL

Locus name

DArT clone ID

Sequence

DART4872

100025017|F|0-28:G > C-28:G > C

TGCAGCAAAAATAGCACCGCCACACAACGTGCGCGGCAGCGCTCCCTCCAGCGACGCGACGCCTAGGAT

DART7508

100020485|F|0-40:G > A-40:G > A

TGCAGGGGGCAAGAGCAAACAAGGCATGATGAGCAAACCAGGCATGGTTGAGAGATCAGGCTAATTGTT

DART7846

100023795|F|0-13:G > A-13:G > A

TGCAGTACCTCGCGCTCTCCGGCAACGAGCTGTCTGGCAAGATACCGCCGAGATCGGAAGAGCGGTTCA

DART3080

100017949|F|0-37:A > G-37:A > G

TGCAGCTCGAAGAGACCCTTGGGAATGGAGCCGTTCAAGTAGTTCTCTCCGAGACGGATACGGCTCAAG

DART3263

100023711|F|0--33:C > A

TGCAGGCTCCCGCAGCCGCTGCTCCGTTCATCCCCCAGCAGCACCAGTACGTCACTCAGACGGGCACGG

DART5481

100009066|F|0--42:A > G

TGCAGCCAACCTTGGATGGAACACACAGAAAACCAGTATGCCAGTCCTCGATTTAAAGATGGGGCTAGA

DART2133

100025595|F|0--17:C > A

TGCAGTCCTGCTCATCTCTTCTTATGGTGACTACATGTTCTTCTTCATCTGGCTGGTCTGAGTTGGATG

DART2681

100009568|F|0--11:A > G

TGCAGTGGAATATAGCAAGGGCGGAGCAGCACAGTCAGTCAAGTCTGCATGCATGCGAGCAACCGTTGC

DART6198

100012213|F|0-56:T > C-56:T > C

TGCAGGTTTTTGAACTTTGAAGAACTCGCGCCGCTGCCTTGGGAAAATGTTTGAATTGTCCAAGGACAT

DART4228

100017110|F|0-68:A > G-68:A > G

TGCAGTTAGTCCAAGAAAGAGGAAAGCTGATGATGGTCTCAGTCTCAGTCCAAGAAAGAGGAAAGCTGA

DART4182

100011760|F|0-59:G > A-59:G > A

TGCAGATTTGTAGTCCACTAGGTACTAGTACTATCTTGTAGCGAGATTGCGAGGTTGCAGTCTCAGGGA

DART5422

100021856|F|0-28:C > A-28:C > A

TGCAGATGGAGACGAGGAGAAGCACGATCGATCCCAGGCCAAAAGGTCCAGCAAATGACATGCAAAGAG

DART462

100004133|F|0-16:C > T-16:C > T

TGCAGAGCTCCTCAACCGTGCCTATTTATCTGCACATGGAGCCTTCAGGGCTTCAGGAAAAATCGCATC

DART4851

100021552|F|0--65:T > C

TGCAGGCATGATCGGAAGTTTTCCCATGCCGCCTCATTCACATCCCAACCGAAATCAACAACAAATAAG

DArT locus names used throughout manuscript derived from clone ID/SNP variant and associated sequence read.

Bioinformatic analysis of the interval containing DArT-seq markers with an r 2 value > 0.81 spanned 5 Mb in total and was gene-rich with 75 genes (>60% uncharacterized) (Table 5). The haplotype block analysis using significant DArT-seq markers showed very high linkage disequilibrium among these markers (data not shown). From the 75 predicted transcripts within this region, there was also a relatively large representation of various transcription factors, while only three predicted disease resistance proteins were identified including NB-ARC, NBS-LRR and a serine/threonine receptor kinase (Table 5).
Table 5

Bioinformatic analysis of functional annotation based on Pfam of the 75 predicted genes in the genomic region on Morex 5HL at the RphCantala locus based on linkage disequilibrium analysis performed on linked DArT-seq markers

Gene identifyer

Physical postion in Morex genome

Sequence annotation Pfam

Length (amino acid residues)

MLOC_67435

Chromosome 5: 504,807,504-504,808,889

Uncharacterised protein

1282

MLOC_63880

Chromosome 5: 504,837,984-504,844,416

Uncharacterised protein

4770

MLOC_63879

Chromosome 5: 504,837,985-504,840,518

Peptidase domain

1900

MLOC_14877

Chromosome 5: 504,848,281-504,851,127

Uncharacterised protein

2578

MLOC_72642

Chromosome 5: 504,851,380-504,854,051

Uncharacterised protein/transmembrane

818

MLOC_15752

Chromosome 5: 504,856,869-504,860,258

Uncharacterised protein//serine/threonine protein kinase

1279

MLOC_67813

Chromosome 5: 504,866,847-504,868,082

Uncharacterised protein

156

MLOC_58355

Chromosome 5: 504,868,629-504,870,096

Uncharacterised protein/Myb homeobox

96

MLOC_39379

Chromosome 5: 504,881,559-504,882,690

CytochromeP450/uncharacterised protein

193

MLOC_55782

Chromosome 5: 505,224,634-505,228,648

Uncharacterised protein/Bromodomain

350

MLOC_12507

Chromosome 5: 505,231,551-505,235,061

Transmembrane domain/uncharacterised protein

99

MLOC_56550

Chromosome 5: 505,251,077-505,252,833

Uncharacterised protein

212

MLOC_67579

Chromosome 5: 505,267,327-505,268,018

Uncharacterised protein

73

MLOC_79114

Chromosome 5: 505,304,761-505,305,695

Uncharacterised protein

180

MLOC_38843

Chromosome 5: 505,401,971-505,402,516

Uncharacterised protein/zipper

144

MLOC_22183

Chromosome 5: 505,411,541-505,418,638

Uncharacterised protein

345

MLOC_22184

Chromosome 5: 505,411,592-505,420,058

Microtubule-associated protein

556

MLOC_44070

Chromosome 5: 505,421,803-505,425,401

Uncharacterised protein

346

MLOC_61309

Chromosome 5: 505,435,524-505,436,686

Uncharacterised protein

176

MLOC_67384

Chromosome 5: 505,437,805-505,442,456

Uncharacterised protein/BIPPOZ fold

190

MLOC_14335

Chromosome 5: 505,450,976-505,451,416

Uncharacterised protein

46

MLOC_78241

Chromosome 5: 505,457,197-505,458,593

Glycosyltransferase 2

363

MLOC_37117

Chromosome 5: 505,487,438-505,491,448

Uncharacterised protein/MIP1 Leuczipper

608

MLOC_63425

Chromosome 5: 505,505,232-505,509,647

Uncharacterised/AP2 transcription factor

631

MLOC_58589

Chromosome 5: 505,517,232-505,521,660

Eukaryotic translation initiation factor 3 subunit C

868

MLOC_71335

Chromosome 5: 505,523,834-505,525,773

Cytochrome P450/Uncharacterised protein

453

MLOC_44341

Chromosome 5: 505,572,931-505,576,253

Uncharacterised protein

515

MLOC_11008

Chromosome 5: 505,604,769-505,610,921

Kinesin motor domain/uncharacterised protein

340

MLOC_55124

Chromosome 5: 506,586,998-506,588,618

Ribosomal S14/predicted protein

56

MLOC_55125

Chromosome 5: 506,594,987-506,597,286

Uncharacterised protein

284

MLOC_64140

Chromosome 5: 506,607,831-506,611,618

Malate dehydrogenase

358

MLOC_39143.3

Chromosome 5: 506,613,176-506,622,502

Uncharacterised protein

503

MLOC_4524

Chromosome 5: 506,631,764-506,637,466

Uncharacterised protein

144

MLOC_63065

Chromosome 5: 506,640,602-506,644,654

Uncharacterised protein/protein-kinase domain leucine rich repeat

608

MLOC_37278

Chromosome 5: 506,647,621-506,649,939

Uncharacterised/cytP450

515

MLOC_11920

Chromosome 5: 506,671,388-506,671,569

Uncharacterised protein

 

MLOC_61101

Chromosome 5: 506,676,442-506,678,678

Alpha/beta hydrolase domain/uncgharacterised

377

MLOC_52788

Chromosome 5: 506,712,820-506,716,335

Alpha-tubulin 4

451

MLOC_52896.1

Chromosome 5: 506,720,817-506,722,983

Myb/Homeobox/Uncharacterised protein

299

MLOC_77955

Chromosome 5: 506,728,560-506,729,777

Homeobox/leucine zipper/uncharacterised protein

154

MLOC_52360.1

Chromosome 5: 506,734,900-506,736,938

tRNA-butesine synthase/uncharacterised protein

240

MLOC_52361

Chromosome 5: 506,737,533-506,741,133

Pentatricopeptide/uncharacterised

682

MLOC_17956

Chromosome 5: 506,743,784-506,750,717

Uncharacterised protein/N-acetylglucosaminyl transferase component (Gpi1)

541

MLOC_66827

Chromosome 5: 506,758,816-506,764,116

AMP-binding enzyme/uncharacterised protein

700

MLOC_71512

Chromosome 5: 506,765,725-506,767,027

Oligopeptide transporter

292

MLOC_71514

Chromosome 5: 506,771,066-506,774,511

Uncharacterised protein

947

MLOC_36533

Chromosome 5: 506,774,624-506,778,739

Giberellin signalling

548

MLOC_36533

Chromosome 5: 506,779,918-506,782,319

NB-ARC protein/uncharacterised protein

591

MLOC_79498

Chromosome 5: 506,783,900-506,786,958

Peptidase/protein inhibition/Uncharacterised protein

377

MLOC_17927

Chromosome 5: 506,792,732-506,798,457

WRKY transcription factor /Uncharacterised protein

1032

MLOC_66348

Chromosome 5: 506,818,362-506,820,563

NAM protein

337

MLOC_16892

Chromosome 5: 506,827,938-506,828,895

Tetraspanin/peripherin/uncharacterised protein

183

MLOC_14114

Chromosome 5: 506,834,758-506,838,333

FAD reductase/uncharacterised

430

MLOC_23699

Chromosome 5: 506,884,357-506,888,420

RNA polymerase III

120

MLOC_70664

Chromosome 5: 506,907,468-506,911,192

Lipoxygenase

863

MLOC_17894

Chromosome 5: 506,912,481-506,913,432

Uncharacterised protein

145

MLOC_10360

Chromosome 5: 506,913,595-506,916,553

NBS-ARC-LRR disease resistance protein/Uncharacterised

766

MLOC_19228

Chromosome 5: 506,923,278-506,929,445

Cullin repeat-like superfamily

351

MLOC_3679

Chromosome 5: 506,929,610-506,930,486

GTP binding Elongation factor

113

MLOC_10567

Chromosome 5: 506,948,227-506,953,875

Inosine-5′-monophosphate dehydrogenase

496

MLOC_44818

Chromosome 5: 506,995,429-506,995,800

Uncharacterised protein

30

MLOC_76586

Chromosome 5: 506,996,531-506,997,720

Uncharacterised protein

51

MLOC_66071

Chromosome 5: 509,522,514-509,527,272

Calmodulin binding protein/uncharacterised

588

MLOC_66074

Chromosome 5: 509,528,020-509,529,376

Photosystem I reaction center subunit III

439

MLOC_62114

Chromosome 5: 509,534,583-509,540,642

Calmodulin binding protein/uncharacterised

615

MLOC_61300

Chromosome 5: 509,556,146-509,556,624

Uncharacterised protein/Zinc finger

137

MLOC_61302

Chromosome 5: 509,560,844-509,561,551

Uncharacterised protein/Zinc finger

156

MLOC_2917

Chromosome 5: 509,561,748-509,564,141

Protein binding GTP-Elongation Factor

322

MLOC_66343

Chromosome 5: 509,613,233-509,613,914

Uncharacterised protein

59

MLOC_7003

Chromosome 5: 509,663,223-509,664,904

Chaperone J

96

MLOC_4695

Chromosome 5: 509,722,893-509,727,266

F-box domain cyclin/Uncharacterised protein

411

MLOC_66212

Chromosome 5: 509,843,699-509,844,569

Uncharacterised protein

245

MLOC_4789

Chromosome 5: 509,860,275-509,861,218

Uncharacterised protein

146

MLOC_12556

Chromosome 5: 509,866,159-509,866,865

Uncharacterised protein

110

MLOC_66971

Chromosome 5: 509,878,445-509,880,991

Ribose 5P isomerase

 

Discussion

Here we report on the discovery and mapping (genetic and physical) of a new seedling resistance allele to P. hordei, previously temporarily designated as RphC. A previous genetic study using a large F2 population determined that the Rph12 resistance locus in ‘Triumph’ was an allele of Rph9 [14] and was therefore re-designated as Rph9.z based on nomenclature described in Franckowiak et al. [23]. Our studies demonstrated that RphC is an allele of Rph12 (Rph9.z) found in ‘Triumph’ based on tests of allelism, chromosomal location and pathotype specificity. Tests of allelism were performed in this study by intercrossing ‘Cantala’ with barley differential lines carrying Rph3, Rph7, Rph10, Rph12 and Rph13. RphC was independent from Rph3, Rph7, Rph10 and Rph13 based on observed segregation ratios conforming to two-gene prediction models. Further genetic analysis of F3 populations demonstrated that there was no segregation for resistance to P. hordei pathotype 253P- between ‘Cantala’ and ‘Triumph’ , suggesting that RphC and Rph12 are likely allelic and therefore RphC should be designated Rph9.am.

Both multipathotype analysis and observed ITs between ‘Cantala’ , ‘Stirling’ and 13 other Australian barley cultivars postulated to carry Rph9.am suggest that the resistance mapped in this study is the same gene. Rph9.am had different specificity than Rph12 (Rph9.z). P. hordei pathotype 253P- was avirulent on Rph9.am and Rph12, however pathotypes 210P+ and 200P- were avirulent on Rph12 yet virulent on Rph9.am. Genetic analysis of the CI 9214/Stirling DH population using the 253P- pathotype conformed to a single gene inheritance contributed by the ‘Stirling’ parent. Further assessment of this population with P. hordei pts 243P+ (avirulent on Rph9.am and virulent on Rph19) and 4610P+ (virulent on Rph12 and Rph19) ruled out the involvement of these genes for the resistance observed in the CI 9214/Stirling population.

Rph9, Rph12 and Rph9.am all map to the long arm of chromosome 5H (5HL). Marker-trait analysis performed in this study using 4,500 DArT markers assigned Rph9.am to chromosome 5HL in a similar region to both Rph9 and Rph12 although there were no comparable markers between genetic maps to accurately assess comparative positions. Comparative genetic analysis between the ‘Bowman’ and CI 9214/Stirling genetic maps identified six markers in common within a 15 cM region of Rph9.am and this region co-located to QTL for barley leaf rust resistance in barley on 5HL located in between 126 and 140 cM from cultivar ‘Scarlett’ [24]. Discrepancies were observed between the order and distance of DArT markers between the parental genetic map (CI 9214/Stirling) and the consensus 'Bowman' genetic maps. This is likely to be attributed to the limited number of lines used for genetic map construction and mapping the Rph9.am phenotype. Additional file 2 gives the marker haplotype data for each closely linked DArT to Rph9.am. A small proportion of markers had missing data and this may further explain the inaccuracy of the marker order and distance observed in the CI 9214/Stirling genetic map. Bioinformatic analysis on sequence reads derived from DArT markers closely linked to Rph9.am (r 2  > 0.8) suggests that there are four likely gene candidates for the Rph9.am/Rph12/Rph9 locus within a 5 Mb gene rich region including an NB-ARC, NBS-LRR and two Serine/Threonine receptor kinases. Variation was observed between the ‘Bowman’ and ‘Morex’ genome assemblies for the physical location of two DArT markers (DART7846 and DART3079), both of which showed highest similarity to the same serine/threonine receptor kinase transcript. Such discrepancies are likely to be either due to errors in assembly between the ‘Bowman’ and ‘Morex’ genomes given their recent release or the absence of MLOC_38941 within ‘Bowman’ , which is seedling susceptible to P. hordei and lacks any of the characterised Rph genes and Rph9.am (R. F. Park, unpublished).

High LD among the significant DArT-seq markers in this region, as indicated by haplotype block analysis, suggests that Rph9.am could be located to a broad region on chromosome 5HL spanning at least 5 Mb. Given the population size of the F3 families used for tests of allelism, it is possible that Rph12 and Rph9.am could be independent closely linked resistance genes separated by a very small physical distance. Bioinformatic analysis of the genes within the physical region believed to carry Rph9.am based on LD and the ‘Bowman’ consensus map suggest the presence of two NBS genes. The role of NBS-LRR genes and their involvement in race specific resistance to rusts and other plant pathogens is well documented [25],[26] as is their tendency to cluster within grass genomes due to selection for duplication events in response to evolutionary pressure [27],[28]. Alternatively, there is a possibility that the same one of the serine/threonine receptor kinase genes is responsible for resistance to multiple pathotypes of P. hordei based on previously reported broad spectrum resistance conferred by both Rpg1 and Rpg5 to stem rust in barley. Both Rpg1 and Rpg5 encode serine/threonine receptor kinases and are believed to show marked homology. Rpg5 maps approximately 20 Mb away from the predicted Rph9.am locus, however, a recent study screening Australian barley cultivars with the Rpg5 marker identified only 6 out of the 14 lines postulated to carry Rph9.am also carried Rpg5 suggesting they are not the same gene [29].

The Australian barley cultivars postulated to carry Rph9.am were all closely related based on available pedigree information. Multipathotype testing performed in this study using five P. hordei pathotypes suggests that Rph9.am is likely to be present in 14 Australian cultivars. Further pedigree analysis of all Australian cultivars postulated to carry Rph9.am demonstrated strong relatedness and shared ancestral pedigrees through ‘Gull’ and ‘Binder’, which trace the source of the Rph9.am resistance to a landrace from either Sweden or the former Czechoslovakia. Both ‘Cantala’ and ‘Stirling’ share a common pedigree in ‘Maja’ that was produced from an intercross between ‘Gull’ and ‘Binder’ [30]. A previous study reporting on the genealogical analysis and diversity of spring barleys released from the former Czechoslovakia and the Czech Republic determined that three ancestral landraces, including ‘LV-Gotland’ , contributed significantly to feed barley cultivars. These cultivars were enriched in germplasm of more productive genotypes and were donors of biotic stress resistance at the sacrifice of malting qualities during breeding [31]. Previous research has also found however that ‘Gull’ is susceptible to Australian P. hordei pathotypes and only carried the Rph4.d allele at the Rph4 locus. This evidence suggests that 'Binder' not 'Gull' is the more probable source of the Rph9.am resistance from ‘Cantala’.

Conclusions

Consolidating both previous and present studies, at least three alleles contributing to leaf rust resistance [Rph9, Rph12 (Rph9.z) and Rph9.am (Rph9.am)], each with distinct race specificity, map to chromosome 5HL at potentially the same locus. Of these three alleles, Rph12 and Rph9.am appear to be most common in Australian germplasm. Genetic mapping and LD analysis in this study determined that Rph9.am is likely to be located in a physical region spanning 5 Mb on chromosome 5HL. Furthermore, this region contained three potential gene candidates which will inform future gene cloning efforts of the Rph12/Rph9.am locus for diagnostic marker development.

Availability of supporting data

All the supporting data in the manuscript are included as additional files.

Additional files

Declarations

Acknowledgements

The authors would like to acknowledge the Grains and Research Development Corporation for funding this work and Mr Matthew Williams and Mrs Huda Elmansour for technical assistance.

Authors’ Affiliations

(1)
Plant Breeding Institute Cobbitty, The University of Sydney
(2)
Faculty of Veterinary Science, University of Sydney

References

  1. Cotterill PJ, Rees RG, Platz GJ: Response of Australian barley cultivars to leaf rust (Puccinia hordei). Aust J Exp Agric. 1994, 34: 783-788. 10.1071/EA9940783.View ArticleGoogle Scholar
  2. Woldeab G, Fininsa C, Singh H, Yuen J: Virulence spectrum of Puccinia hordei in barley production systems in Ethiopia. Plant Pathol. 2006, 55: 351-357. 10.1111/j.1365-3059.2006.01357.x.View ArticleGoogle Scholar
  3. Murray GM, Brennan JP: The current and potential costs from diseases of barley in Australia. Grains Research and Development Corporation. Canberra Australia. 2009, 59.Google Scholar
  4. Park RF, Karakousis A: Characterization and mapping of gene Rph19 conferring resistance to Puccinia hordei in cultivar ‘Reka I’ and several Australian barleys. Plant Breed. 2002, 121: 232-236. 10.1046/j.1439-0523.2002.00717.x.View ArticleGoogle Scholar
  5. Park RF: Breeding cereals for rust resistance in Australia. Plant Pathol. 2008, 57: 591-602. 10.1111/j.1365-3059.2008.01836.x.View ArticleGoogle Scholar
  6. Golegaonkar PG, Park RF, Singh D: Evaluation of seedling and adult plant resistance to Puccinia hordei in barley. Euphyt. 2009, 166: 183-197. 10.1007/s10681-008-9814-2.View ArticleGoogle Scholar
  7. Sandhu KS, Forrest KL, Kong S, Bansal UK, Singh D, Hayden MJ, Park RF: Inheritance and molecular mapping of a gene conferring seedling resistance against Puccinia hordei in the barley cultivar Ricardo. Theor Appl Genet. 2012, 125 (7): 1403-1411. 10.1007/s00122-012-1921-8.View ArticlePubMedGoogle Scholar
  8. Johnson PA, Niks RE, Meiyalaghan V, Blanchet E, Pickering P: Rph22: mapping of a novel leaf rust resistance gene introgressed from the non-host Hordeum bulbosum L into cultivated barley (Hordeum vulgare L). Theor Appl Genet. 2014, 126 (6): 1613-1625. 10.1007/s00122-013-2078-9.View ArticleGoogle Scholar
  9. Park RF: Pathogenic specialization and pathotype distribution of Puccinia hordei in Australia 1992 to 2001. Plant Dis. 2003, 87: 1311-1316. 10.1094/PDIS.2003.87.11.1311.View ArticleGoogle Scholar
  10. Clifford BC: Barley leaf rust. In The Cereal Rusts II. Edited by Roelfs AP,Bushnell WR. New York, USA: Academic Press; 1985:173–205.Google Scholar
  11. Wallwork H, Preece P, Cotterhill PJ: Puccinia hordei on barley and Omithogalum umbellatum in South Australia. Austral Plant Pathol. 1992, 1992 (21): 95-97. 10.1071/APP9920095.View ArticleGoogle Scholar
  12. Steffenson BJ, Jin Y, Griffey CA: Pathotypes of Puccinia hordei with virulence for the barley leaf rust resistance gene Rph7 in the United States. Plant Dis. 1993, 77: 867-869. 10.1094/PD-77-0867.View ArticleGoogle Scholar
  13. Zhong SB, Effertz RJ, Jin Y, Jerome D, Franckowiak J, Steffenson BJ: Molecular mapping of the leaf rust resistance gene Rph6 in barley and its linkage relationships with Rph5 and Rph7 . Phytopathol. 2003, 93: 604-609. 10.1094/PHYTO.2003.93.5.604.View ArticleGoogle Scholar
  14. Borovkova IG, Jin Y, Steffenson BJ: Chromosomal location and genetic relationship of leaf rust resistance genes Rph9 and Rph12 in barley. Phytopathol. 1998, 88: 76-80. 10.1094/PHYTO.1998.88.1.76.View ArticleGoogle Scholar
  15. Weerasena JS, Steffenson BJ, Falk AB: Conversion of an amplified fragment length polymorphism marker into a co-dominant marker in the mapping of the Rph15 gene conferring resistance to barley leaf rust, Puccinia hordei Otth. Theor Appl Genet 2014, 108(4):712–719.View ArticleGoogle Scholar
  16. McIntosh RA, Wellings CR, Park RF: Wheat Rusts: An Atlas of Resistance Genes.Canberra Australia: CSIRO publications; 1995.View ArticleGoogle Scholar
  17. Fulton TM, Chunwongse J, Tanksley SD: Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Mol Biol Repr. 1995, 13: 207-209. 10.1007/BF02670897.View ArticleGoogle Scholar
  18. Courtois B, Audebert A, Dardou A, Roques S, Ghneim- Herrera T, Droc G, Frouin J, Rouan L, Gozé E, Kilian A, Ahmadi N, Dingkuhn M: Genome-wide association mapping of root traits in a japonica rice panel. PLoS One. 2013, 8 (11): e78037-10.1371/journal.pone.0078037.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Wu Y, Bhat PR, Close TJ, Lonardi S: Efficient and accurate construction of genetic linkage maps from the minimum spanning tree of a graph. PLoS Genet. 2008, 4: e1000212-10.1371/journal.pgen.1000212.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Mayer KF, Waugh R, Brown JW, Schulman A, Langridge P, Platzer M, Fincher GB, Muehlbauer GJ, Sato K, Close TJ, Wise RP, Stein N: A physical, genetic and functional sequence assembly of the barley genome. Nature. 2012, 491: 711-716.PubMedGoogle Scholar
  21. Abecasis GR, Cookson WO: GOLD–graphical overview of linkage disequilibrium. Bioinform. 2000, 16: 182-183. 10.1093/bioinformatics/16.2.182.View ArticleGoogle Scholar
  22. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformat. 2005, 21: 263-265. 10.1093/bioinformatics/bth457.View ArticleGoogle Scholar
  23. Franckowiak JD, Jin Y, Steffenson BJ: Recommended allele symbols for leaf rust resistance genes in barley. Barley Genet News 1997, 27:36–44.Google Scholar
  24. von Korff M, Wang H, Leon J, Pillen KP: AB-QTL analysis in spring barley. I. detection of resistance genes against powdery mildew, leaf rust and scald introgressed from wild barley. Theor Appl Genet. 2005, 111: 583-590. 10.1007/s00122-005-2049-x.View ArticlePubMedGoogle Scholar
  25. Dangl J, Jones J: The plant immune system. Nature. 2006, 444: 323-329. 10.1038/nature05286.View ArticlePubMedGoogle Scholar
  26. Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW: Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis . Plant Cell. 2003, 15: 809-834. 10.1105/tpc.009308.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Zhou T, Wang Y, Chen JQ, Arakim H, Jing Z, Jiang K, Shen J, Tian D: Genome-wide identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR NBS-LRR genes. Mol Genet Genom. 2004, 271: 402-414. 10.1007/s00438-004-0990-z.View ArticleGoogle Scholar
  28. Dracatos PM, Cogan NOI, Sawbridge TI, Gendall AR, Smith KF, Spangenberg G, Forster JW: Molecular characterisation and genetic mapping of candidate genes for qualitative disease resistance in perennial ryegrass (Lolium perenne L.). BMC Plant Biol. 2009, 9: 62-10.1186/1471-2229-9-62.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Derevnina L, Fetch T, Singh D, Brueggeman R, Dong C, Park RF: Analysis of stem rust resistance in Australian barley cultivars. Plant Dis 2014. http://dx.doi.org/10.1094/PDIS-11-13-1174-RE
  30. Gustafsson J: Mutation experiments in barley. Hereditas. 1941, 27: 225-242.Google Scholar
  31. Milotova J, Martynov SP, Dobrotvorskaya TV, Vaculova K: Genealogical analysis of the diversity of spring barley cultivars released in former Czechoslovakia and modern Czech Republic. Russ J of Genet. 2008, 44 (1): 51-59. 10.1134/S1022795408010079.View ArticleGoogle Scholar
  32. Hanson WD: Minimum family sizes for planning of genetic experiments. Agron J. 1959, 51: 711-715. 10.2134/agronj1959.00021962005100120005x.View ArticleGoogle Scholar

Copyright

© Dracatos et al.; licensee BioMed Central. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement