Skip to main content

Table 4 Summary information for significant DArT-seq markers in linkage disquilibrium (r2 > 0.8) with RphCantala on chromosome 5HL

From: Genetic mapping of a new race specific resistance allele effective to Puccinia hordei at the Rph9/Rph12locus on chromosome 5HL in barley

Locus name DArT clone ID Sequence
DART4872 100025017|F|0-28:G > C-28:G > C TGCAGCAAAAATAGCACCGCCACACAACGTGCGCGGCAGCGCTCCCTCCAGCGACGCGACGCCTAGGAT
DART7508 100020485|F|0-40:G > A-40:G > A TGCAGGGGGCAAGAGCAAACAAGGCATGATGAGCAAACCAGGCATGGTTGAGAGATCAGGCTAATTGTT
DART7846 100023795|F|0-13:G > A-13:G > A TGCAGTACCTCGCGCTCTCCGGCAACGAGCTGTCTGGCAAGATACCGCCGAGATCGGAAGAGCGGTTCA
DART3080 100017949|F|0-37:A > G-37:A > G TGCAGCTCGAAGAGACCCTTGGGAATGGAGCCGTTCAAGTAGTTCTCTCCGAGACGGATACGGCTCAAG
DART3263 100023711|F|0--33:C > A TGCAGGCTCCCGCAGCCGCTGCTCCGTTCATCCCCCAGCAGCACCAGTACGTCACTCAGACGGGCACGG
DART5481 100009066|F|0--42:A > G TGCAGCCAACCTTGGATGGAACACACAGAAAACCAGTATGCCAGTCCTCGATTTAAAGATGGGGCTAGA
DART2133 100025595|F|0--17:C > A TGCAGTCCTGCTCATCTCTTCTTATGGTGACTACATGTTCTTCTTCATCTGGCTGGTCTGAGTTGGATG
DART2681 100009568|F|0--11:A > G TGCAGTGGAATATAGCAAGGGCGGAGCAGCACAGTCAGTCAAGTCTGCATGCATGCGAGCAACCGTTGC
DART6198 100012213|F|0-56:T > C-56:T > C TGCAGGTTTTTGAACTTTGAAGAACTCGCGCCGCTGCCTTGGGAAAATGTTTGAATTGTCCAAGGACAT
DART4228 100017110|F|0-68:A > G-68:A > G TGCAGTTAGTCCAAGAAAGAGGAAAGCTGATGATGGTCTCAGTCTCAGTCCAAGAAAGAGGAAAGCTGA
DART4182 100011760|F|0-59:G > A-59:G > A TGCAGATTTGTAGTCCACTAGGTACTAGTACTATCTTGTAGCGAGATTGCGAGGTTGCAGTCTCAGGGA
DART5422 100021856|F|0-28:C > A-28:C > A TGCAGATGGAGACGAGGAGAAGCACGATCGATCCCAGGCCAAAAGGTCCAGCAAATGACATGCAAAGAG
DART462 100004133|F|0-16:C > T-16:C > T TGCAGAGCTCCTCAACCGTGCCTATTTATCTGCACATGGAGCCTTCAGGGCTTCAGGAAAAATCGCATC
DART4851 100021552|F|0--65:T > C TGCAGGCATGATCGGAAGTTTTCCCATGCCGCCTCATTCACATCCCAACCGAAATCAACAACAAATAAG
  1. DArT locus names used throughout manuscript derived from clone ID/SNP variant and associated sequence read.