Screening of BaMV infection-induced genes in N. benthamiana by cDNA-AFLP

Total RNA was extracted from the mock- and BaMV-inoculated leaves 1, 3, 5, and 7 days post inoculation, to identify differentially expressed genes in N. benthamiana plants following infection with BaMV. To avoid genomic contamination of the DNA and to enhance the efficiency of reverse transcription, we generated the cDNA from oligo (dT)-purified mRNAs and confirmed the efficiency of synthesizing cDNA on a 5% polyacrylamide gel before proceeding with the production of a standard cDNA-AFLP template [27].

To rule out false-positive signals in cDNA-AFLP, we compared the products from two different batches of mRNA, derived from two independent inoculation experiments together on the same gel. In this study, we used eight different primer pairs, T-AC/M-AC, T-AC/M-AG, T-AC/M-CA, T-AC/M-CT, T-AC/M-GA, T-AC/M-GT, T-AC/M-TC, and T-AC/M-TG, to generate the cDNA expression profiles through selective amplification of PCR (Figure 1). Identifying the cDNA fragments of differential levels was simple when lined up together as shown in Figure 1, from which we analyzed the amplified products derived from the T-CA/M-GA primer pair. We assigned positive bands only when the same banding profiles occurred in both batches. The eight primer pairs allowed detection of approximately 90 differentially expressed cDNA bands. Separation of these fluorescently labeled cDNA-AFLP fragments using 6.5% polyacrylamide sequencing gel, imaged with a fluorescent scanner, and eluted from the gel, identified 49 fragments for up-regulation and 41 for down-regulation, following inoculation with BaMV (Table 1).

Identification of major cDNA species from bands containing multiple genes

We next amplified and cloned the cDNA bands eluted from the cDNA-AFLP gels; DNA sequencing of 6 to 18 clones from each cloning revealed the identity of the cDNA inserts. Sequencing results from approximately 944 clones, indicated that two-thirds (62/90) of the cropped gel fragments contained cDNAs of multiple genes (Additional file 1). These results had been expected, because the gel fragments included any cDNAs in the region. Therefore, further analysis was required to confirm the identity of the genes differentially expressed between mock- and BaMV-inoculated samples.

Logically, the clone identified at the highest frequency using DNA sequencing would correspond to the differentially expressed cDNA detected in each gel fragment (Additional file 1). However, there was the possibility of skewed efficiency in the process of cloning the cDNA fragments. Target-specific semi-quantitative RT-PCR was performed to examine whether the expression pattern of the major cDNA species identified in each band, was correlated with the signals in the cDNA-AFLP profile (Figure 2). A third batch of independently inoculated plants provided the mRNA templates used for this experiment. We designed gene-specific primers according to the DNA sequences of the major cDNA clones for more than 10 bands (Additional file 1). Figure 2 shows representative results of RT-PCR analysis including those of ACAG2-1, ACCT8-1, ACCT2-1, and ACCT13. Overall, the expression patterns for all examined targets were consistent with those in the cDNA-AFLP profile. Therefore, we tentatively assigned the major cDNA species identified from each band as representative of cDNA in all 90 bands (Table 2).

Sequence analysis of differentially expressed cDNA fragments

Sequence analysis of the major cDNA species listed in Table 2 revealed that twenty-two of the 90-cDNA fragments shared no significant homology with any known sequences found in the databases. On the other hand, we found analogs for 68 cDNA fragments of which more than two-thirds were sequences derived from N. tabacum, Arabidopsis, and rice (Table 2). Among these, 53 led to blast matches of biological significance as suggested by the E-values (Table 2). Table 2 lists the genes categorized according to function: twenty-two genes were involved in cell rescue, defense, death, and aging; 12 in energy; 8 in transcription; 8 in metabolism; 4 in translation; 4 in signal transduction, and 10 could not be classified. Interestingly, three of the genes, namely the mpv17/PMP22 family protein (ACAC8-1 and ACTC8-1), chloroplast carbonic anhydrase (ACAG8, ACAG10, and ACTC4-1), and lipid transferase (ACGT12 and ACAG9) were isolated from different selective primer sets, which remarkably led to identical cDNA-AFLP expression patterns for each target (Table 2). These results implied that the cDNA-AFLP technique is a reliable and reproducible means to identify differentially expressed genes.

Effect of gene-specific knockdown on the accumulation of BaMV

To investigate the roles of the differentially expressed genes identified by cDNA-AFLP analysis in BaMV infection cycle, the TRV VIGS system [28], which has been used widely to knock down homologous genes in N. benthamiana [29], was adopted to generate gene-specific knockdown plants. We evaluated the effects of lowered expression levels of individual host genes on the replication of BaMV, i.e. viral RNA and the accumulation of protein.

To assess the effect of the TRV vector in N. benthamiana, GFP or Luciferase ORF (non plant-derived DNA) were introduced to the pTRV2 vector to serve as a control. Fifteen genes, picked randomly from each assigned functional category (Table 2) for knockdown experiments showed no significant effect on plant growth or development. Most of these knockdown plants (Table 3) exhibited no difference in morphology to that of the control plants (Figures 3 and Additional file 2). However, yellowing mosaics occurred on leaves of the ACAG1 (a putative ferredoxin-NADP⁺ reductase; FNR) of the knockdown plants (Figure 3). The results of the studies of BaMV regarding ACAG1 and ACAG8 (a putative chloroplast carbonic anhydrase, cCA) in the knockdown plants are described here to represent our observations of these 15 knockdown plants (Figures 3 and 4). We used semi-quantitative RT-PCR to assess the knockdown efficiency of the VIGS system (Figures 5 and Additional file 2) and Western blot analysis to determine the accumulation of BaMV coat protein in the inoculated leaves. Results indicate that mRNA levels of the FNR gene were reduced to 47% that of the control plants (Figure 4A). Western blot analysis of BaMV coat protein detected a nearly two-fold accumulation in 5 dpi samples in these plants (Figure 4B). The mRNA levels of the cCA gene were reduced to 76% (significance in t-test) in the knockdown plants (Figure 4C) leading to a reduction in the accumulation of coat protein to 63% that of the control plants (Figure 4D). These results suggest that FNR might play a role preventing the accumulation of BaMV, whereas cCA could facilitate the accumulation of BaMV.

TDFa	Expressionb	Protein candidate	CPc	Significanced
ACCT13	+	regulator of gene silencing [N. tabacum]	72 ± 3
ACGT4	+	thioredoxin h-like protein [N. tabacum]	181 ± 43	**
ACGT11-1	+	plasma membrane polypeptide [N. tabacum]	172 ± 49	**
ACAG2-1	+	NEP1-interacting protein 2 [Arabidopsis thaliana]	191 ± 14	***
ACCA10	+	AER [N. tabacum]	77 ± 32
ACCT1-1	-	CDK-activating kinase[Candida dubliniensis CD36]	197 ± 25	**
ACCT5-1	-	lysine ketoglutarate reductaselysine trans-splicing [Zea mays]	74 ± 24
ACAG8	-	chloroplast carbonic anhydrase [N. benthamiana]	68 ± 14	*
ACGT2-1	-	photosystem II 23 kDa polypeptide [N. tabacum]	149 ± 40	**
ACAG1	-	ferredoxin--NADP(+) reductase [N. tabacum]	190 ± 24	**
ACGT12	-	lipid transferase [N. tabacum]	42 ± 18	***
ACTC5-1	-	ribosomal protein L20 [N. tabacum]	73 ± 17
ACCT3-1	-	hypothetical protein [N. tabacum]	70 ± 30
ACCA3	+	mRNA C-7 [N. tabacum]	56 ± 26	**
ACGA3-1	+	No significant match	107 ± 16

^aTDF: transcript-derived fragment

^bExpression: up-regulated (+) or down-regulated (-) cDNA-AFLP signals detected in virus-infected leaves, compared to mock-infected leaves

^cCP: the coat protein accumulation levels of BaMV in knockdown plants

^dSignificance: Asterisks indicate statistically significant differences compared with the control plants (*p < 0.05, **p < 0.01, ***p < 0.001)

Among the 15 genes analyzed (by VIGS knockdown experiments), we found that the levels of accumulated coat protein significantly increased in six knockdown plants suggesting that these six genes play a role in counteracting BaMV infection (Figures 5A and Table 3). Three knockdown plants showed a significant reduction in the level of coat protein, implying that these three genes play a positive role in the accumulation of BaMV in plants. No statistically significant difference was shown between the six remaining knockdown plants and the control plants when inoculated with BaMV. Interestingly, all of the genes playing a potentially negative role in the accumulation of BaMV within the categories related to cell rescue, defense, death, ageing, signal transduction, and energy. These results suggest that the proteins involved in signal transduction pathways related to pathogen defense might be involved in resistance to BaMV in N. benthamiana plants. Finally, approximately three-fifths of the 15 randomly picked, differentially expressed genes showed either a positive or a negative influence on the accumulation of BaMV in plants.

Plant material and viral inoculation

Plants (Nicotiana benthamiana) were grown in a growth chamber with a 16 h day length at 28°C. Six-week-old plants were mechanically inoculated with 500 ng of BaMV on each leaf. Virus- and mock-inoculated leaves were harvested on day 1, 3, 5 or 7 post-inoculation (dpi).

Plant mRNAs isolation

Total RNA was extracted from 3 g of leaves. The leaves were ground to powder with liquid nitrogen and mixed with 6 ml of STE buffer (100 mM Tris-HCl, pH 8.0, 100 mM NaCl and 10 mM EDTA), 660 μl of 10% SDS and 180 μl of 100 mg/ml bentonite. The mixture was centrifuged at 12000 rpm for 10 min at 4°C (Sigma model 3MK centrifuge) after three times of phenol/chloroform extraction. Total RNA in the supernatant was ethanol precipitated, stored at -80°C, and subjected to poly(A) RNA isolation by using oligo(dT)-coupled paramagnetic beads. Briefly, 100 μl of the total RNA (75 μg) were heated at 65°C for 2 min to disrupt secondary structure and then placed on ice. About 200 μl of Dynabeads Oligo (dT)25 (Dynal A.S., Oslo, Norway) were washed twice with 100 μl of binding buffer (20 mM Tris-HCl pH 7.5, 1.0 M LiCl, 2 mM EDTA) and resuspended in 100 μl of binding buffer. The beads were incubated with total RNA for 3-5 min at room temperature, washed twice with 200 μl of washing buffer (10 mM Tris-HCl pH 7.5, 0.15 M LiCl, 1 mM EDTA) and resuspend in 10 μl of deionized water to elute the mRNA.

cDNA synthesis

For the first-strand cDNA synthesis, the 20-μl reaction containing 750 ng of mRNA, 30 pmole of Oligo (dT)₄₀, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl₂, 1 mM dNTP,10 mM DTT, and 1 μl of 200 U/μl SuperScript^® III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA)was incubate at 42°C for 90 min. Following removal of the mRNA by alkaline lysis, the cDNA was ethanol precipitated, washed, dried, and dissolved in 10 μl of deionized water. The second-strand cDNA was synthesized in a 10-μl reaction containing 4 μl of first-strand cDNA, 10 mM Tris-HCl (pH 7.5), 5 mM MgCl₂, 7.5 mM DTT, 10 mM dNTP, and 2.5 units of Klenow polymerase (New England Biolabs, Beverly, MA, USA) at 25°C for 30 min. The enzyme was inactivated with 100 mM EDTA for 20 min at 75°C.

cDNA-AFLP

cDNA-AFLP was carried out using the AFLP^® Expression Analysis Kits (LI-COR Biosciences, Lincoln, NE, USA), according to the protocols provided by the manufacturer. Double-strand cDNA was sequentially digested with TaqI at 65°C for 2 hours and with MseI at 37°C for another 2 hours. After inactivation of the restriction enzymes at 80°C for 20 min, 9 μl of the adapter mixture containing the adapters (TaqI adapters: 5'GCGCGCCGTAGACTGCGTAC 3', 5'CGGTACGCAGTCTACGGCGCGC3', MseI adapters: 5'GGCCGCCGATGAGTCCTGAG3', 5'TACTCAGGACTCATCGGCGGCC3'), 0.4 mM ATP, 10 mM Tris-HCl pH 7.5, 10 mM Mg(OAc)₂, 50 mM KOAc, and 6 Weiss units of T4 DNA ligase (New England Biolabs) were added to the restriction digestion mixture and incubated at 20°C for 2 hours.

Subsequently, twenty cycles of pre-amplification were carried out in a 20-μl reaction containing 2.5 μl of 30-fold diluted cDNA template, 100 pmole each of TaqI primer (5'GTAGACTGCGTAC3') and MseI primer (5'GATGAGTCCTGAG3'), 0.25 mM dNTP, 1.5 mM MgCl₂, and 5 units of Taq DNA polymerase (Promega, Madison, WI, USA). The PCR thermal cycling consisting of 20 cycles of 94°C for 30 sec, 56°C for 1 min, and 72°C for 1 min was performed on a GeneAmp PCR system 9600 instrument (Applied Biosystems, Foster city, CA, USA). The amplification products (i.e. the secondary template) were diluted 300 folds and subjected to selective amplification. The reaction contained 6 μl of Taq DNA polymerase working mix (20 mM Tris-HCl pH 8.4, 1.5 mM MgCl₂, 100 mM KCl and 0.75 unit Taq DNA polymerase), 2 μl of the secondary template, 2 μl of MseI primer, and 0.5 μl of IRDye™ 700-labeled TaqI primer. The amplification conditions are as follows: 13 cycles of 94°C for 30 sec, 65°C for 30 sec (temperature increment reduction of 0.7°C per cycle), and 72°C for 1 min, followed by 23 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1 min. Samples were denatured at 95°C for 5 min after the addition of stop solution (10 mM NaOH, 95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol) and separated on a 6.5% KB^Plus™ gel. Labeled DNA fragments were visualized and recorded by the automatic DNA Sequencer LI-COR 4300 (LI-COR Biosciences)

Isolating and sequencing the differentially expressed cDNA fragments

The bands of interest, namely the transcript-derived fragments TDF, were marked on the Odyssey™ Scanner (LI-COR Biosciences), cut out with a sterile razor blade, and soaked in 10 μl of TE buffer (10 mM Tris-HCl pH8.0, 1 mM EDTA). Following a series of freeze-thaw steps, the cDNA fragments were leached out from the gel by centrifugation at the top speed of a microfuge for 20 min at 4°C. Re-amplification of the cDNA fragments was carried out under the same conditions of the pre-amplification step. The PCR products were separated on a 5% polyacrylamide gel and cloned into pGEM^®-T Easy vector (Promega). DNA sequencing was conducted using the Simultaneous Bi-directional Sequencing (SBS™) method (LI-COR) on a Global IR² System (LI-COR). DNA sequence homology search within the GenBank^® database was performed using BLAST [33].

Semi-quantitative RT-PCR

First-strand cDNA of RNA prepared from mock- or BaMV-inoculated N. benthamiana plants was synthesized with d(T)₃₉ primer using SuperScrpt^® III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Four sets of primers were used to confirm the expression profiles of four cDNA fragments identified by cDNA-AFLP, namely ACAG2-1, ACCT8-1, ACCT2-1, and ACCT13. The forward primers are (5'GAACAAAAAAATGGAGTTTTA3'), (5'CGAACTCCCAACTGGCTTTC3'), (5'CTCTGGAAAGGAGAGCAATGTC3'), and (5'GAACGCTTTGATGAGAATAGAGA3') and the reverse primers (5'GTCATTGCTCCTAATAAGGT3'), (5'CTCCTCCAGAAGCAAATAGTTTC3'), (5'CGAACAAATTGGTGTATCC3'), and (5'CTAACTCAACCGCAGCCTTT3'), respectively. PCR amplifications were performed using Taq DNA polymerase (Promega) with 28 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec. PCR products were separated on a 5% polyacrylamide gel and visualized by EtBr staining.

Primer pairs for ACAG1 (forward, 5'GAGAAAATGAAGGAGAAGGCCC3'; reverse, 5'GCTCTGCCTTCTTCAATTGCTTCTT3') and ACAG8 (forward, 5'GAAGGAAGCTGTGAATGTGTCA3'; reverse, 5'TGGTTAAGTTCATACGGAAAGA3') were used to determine the knockdown efficiency of host genes by VIGS (virus-induced gene silencing). The actin primer pair (forward, 5'GTGGTTTCATGAATGCCAGCA3'; reverse 5'GATGAAGATACTCACAGAAAGA3') was used for normalization of RT-PCR data.

Virus-induced gene silencing (VIGS)

Two transcript-derived fragments (ACAG1 and ACAG8) were first cloned into pGEM-T Easy vector (Promega) and subcloned into the EcoRI site of the pTRV2 vector [28]. The control plasmid pTRV2/mGFP was obtained by subcloning the KpnI-XhoI fragment containing the polyhistidine-tagged mGFP5-coding sequence [34] from pBI-mGFP1 into pTRV2. The pTRV2/ACAG1, pTRV2/ACAG8 and pTRV2/mGFP constructs were transformed into Agrobacterium tumefaciens C58C1 strain by electroporation.

For agroinfiltration, the A. tumefaciens C58C1 containing pTRV1, pTRV2/mGFP, pTRV2/ACAG1, or pTRV2/ACAG8 was cultured to OD₆₀₀ = 1 at 30°C and subjected to induction in 150 μM acetosyringone and 10 mM MgCl₂ for 2 h at room temperature. Subsequently, the pTRV2/mGFP-, pTRV2/ACAG1- or pTRV2/ACAG8-containing A. tumefaciens C58C1 was mixed with the pTRV1-containing A. tumefaciens C58C1 at a 1:1 (v:v) ratio. The 2^nd and 3^rd true leaves were infiltrated with the mixture at the four-leaf stage (seedlings with two cotyledons and two leaves). BaMV virion RNA (1 μg) was inoculated onto the 7^th leaf when the plants were mature. Total RNAs and proteins were extracted from the leaves on 5 dpi for subsequent studies.

Protein detection

Total proteins of the leaves were extracted in 1x Laemmli buffer (2.5 mM Tris-HCl, pH 8.3, 250 mM glycine and 0.1% SDS) and incubated in boiling water for 5 min. Proteins separated by SDS-PAGE were subjected to Western blotting analysis using the polyclonal rabbit anti-BaMV coat protein antibody. The relative levels of the Rubisco large subunit (rbcL) in gels stained with Coomassie Blue were determined and used for the normalization of the Western blotting signals.