Open Access

Development and characterization of microsatellite markers for Morus spp. and assessment of their transferability to other closely related species

  • Balachandran Mathithumilan1,
  • Niteen Narharirao Kadam1,
  • Jyoti Biradar2,
  • Sowmya H Reddy1,
  • Mahadeva Ankaiah1,
  • Madhura J Narayanan1,
  • Udayakumar Makarla1,
  • Paramjit Khurana3 and
  • Sheshshayee Madavalam Sreeman1Email author
Contributed equally
BMC Plant Biology201313:194

https://doi.org/10.1186/1471-2229-13-194

Received: 2 May 2013

Accepted: 13 November 2013

Published: 1 December 2013

Abstract

Background

Adoption of genomics based breeding has emerged as a promising approach for achieving comprehensive crop improvement. Such an approach is more relevant in the case of perennial species like mulberry. However, unavailability of genomic resources of co-dominant marker systems has been the major constraint for adopting molecular breeding to achieve genetic enhancement of Mulberry. The goal of this study was to develop and characterize a large number of locus specific genic and genomic SSR markers which can be effectively used for molecular characterization of mulberry species/genotypes.

Result

We analyzed a total of 3485 DNA sequences including genomic and expressed sequences (ESTs) of mulberry (Morus alba L.) genome. We identified 358 sequences to develop appropriate microsatellite primer pairs representing 222 genomic and 136 EST regions. Primers amplifying locus specific regions of Dudia white (a genotype of Morus alba L), were identified and 137 genomic and 51 genic SSR markers were standardized. A two pronged strategy was adopted to assess the applicability of these SSR markers using mulberry species and genotypes along with a few closely related species belonging to the family Moraceae viz., Ficus, Fig and Jackfruit. While 100% of these markers amplified specific loci on the mulberry genome, 79% were transferable to other related species indicating the robustness of these markers and the potential they hold in analyzing the molecular and genetic diversity among mulberry germplasm as well as other related species. The inherent ability of these markers in detecting heterozygosity combined with a high average polymorphic information content (PIC) of 0.559 ranging between 0.076 and 0.943 clearly demonstrates their potential as genomic resources in diversity analysis. The dissimilarity coefficient determined based on Neighbor joining method, revealed that the markers were successful in segregating the mulberry species, genotypes and other related species into distinct clusters.

Conclusion

We report a total of 188 genomic and genic SSR markers in Morus alba L. A large proportion of these markers (164) were polymorphic both among mulberry species and genotypes. A substantial number of these markers (149) were also transferable to other related species like Ficus, Fig and Jackfruit. The extent of polymorphism revealed and the ability to detect heterozygosity among the cross pollinated mulberry species and genotypes render these markers an invaluable genomic resource that can be utilized in assessing molecular diversity as well as in QTL mapping and subsequently mulberry crop improvement through MAS.

Background

Mulberry, a perennial out-breeding tree species is distributed in varied environments ranging from tropical to sub-arctic regions. The wide distribution can be attributed to its capability to adapt to diverse agro-climatic conditions, fast regeneration and both sexual and asexual modes of propagation. The mulberry leaf serves as the sole source of food to the domesticated silkworm, Bombyxmori L., and hence contributes significantly to the success of silk industry in India. It is predicted that around 27,000 MT of raw silk would need to be produced by the year 2030 to meet the demand in India [1]. This goal is strongly dependant on improving mulberry productivity. Enhancing the yield potential and minimizing the yield loss due to stresses are therefore the most viable strategies to achieve genetic enhancement of mulberry [2].

Despite the significant progress achieved so far, genetic improvement of mulberry yield potential through conventional breeding has been distressingly slow, mainly because of the perennial growth habit and complex inheritance pattern. Convincing evidences suggest that relevant traits need to be introgressed onto an elite genetic background to achieve greater success in crop improvement endeavors. Thus, the applications of modern molecular and genomic tools are expected to strongly complement the breeding efforts in enhancing yield potential of mulberry [2]. Advances in PCR based genomic approaches have generated robust DNA marker systems [3, 4], which offer an effective approach to augment breeding methods for mulberry improvement [5]. Randomly amplified polymorphic DNA (RAPD), Amplified fragment length polymorphism (AFLP) and Inter simple sequence repeats (ISSR) have been the most frequently employed marker systems to study the genetic diversity among mulberry species and genotypes [68]. Though these marker systems provide a good option to discriminate the evolutionary relationships among species [9], being dominant, RAPD, AFLP and ISSR markers have limited application in marker assisted breeding, especially in heterozygous out-breeding perennial species like mulberry. Lack of sufficient number of co-dominant marker systems renders molecular breeding practices in mulberry still a distant possibility.

Microsatellites or simple sequence repeats (SSR) are short stretches of tandemly repeated DNA sequences, distributed throughout the eukaryotic genome [10, 11]. SSR markers display locus specificity, are co-dominant and highly transferable to other related species [12] and hence are the most attractive choice of marker systems for mulberry. Further, the higher ability to detect polymorphism by the SSR markers is an added advantage while analyzing closely related species and/or genotypes, which is often the case in breeding programs [13]. The efficiency of the SSR markers in genetic screening has been reported in tree species like peach, olive and fig [1416].

Except for the reports of Aggarwal et al. [17] and Zhao et al. [18], there have not been many efforts in developing co-dominant markers in mulberry. From this background, the main aim of this work was to generate SSR markers for characterizing mulberry germplasm and/or mapping populations. We report a large number of genic and genomic SSR markers for mulberry and examined their transferability to closely related species like Ficus (Ficusbengalensis), Fig (Ficuscarica) and Jackfruit (Artocarpusheterophyllus).

Result and discussion

Pre-cloning enrichment strategy was adopted to isolate the genomic microsatellite regions and a set of previously characterized expressed sequence tags (ESTs) [1921] were analyzed to identify genic microsatellite regions. A total of 3485 sequences, including 1094 genomic and 2391 EST sequences were analyzed for the presence of microsatellite regions. Locus specific primers were designed for such target sequences to develop SSR markers.

Isolation and characterization of genomic microsatellites

Analysis of the genomic sequences revealed a total of 900 diverse microsatellite loci (Table 1). Among them, 167 (18.56%) sequences had mono nucleotide repeats (MNR) followed by 303 (33.67%) sequences with di-nucleotide repeats (DNR). Tri nucleotide repeats (TNR) were found among 155 (17.22%) sequences while tetra (TtNR), penta (PNR) and hexa (HNR) nucleotide repeats were relatively less frequent in the enrichment library (Figure 1). Besides these types, 52 (5.78%) microsatellite loci with repeat motifs having more than six nucleotide bases referred to as long nucleotide repeats (LNR) were also identified. It is well accepted that di, tri, tetra, penta and hexa repeat motifs represent an appropriate marker system and can generally distinguish greater diversity [22]. Hence, the LNRs and MNRs were excluded from designing locus specific primers. In our study, “TC/AG” repeats constituted the most frequent DNR microsatellite variant (25.5%) followed by “CT/GA”. While “AT/TA” and “AG/TC” repeats were reported as the most frequent in plant genomes [17, 2329]. He et al. [30] identified “GA/CT” as the most frequently occurring di-repeat motifs in groundnut. Our results revealed the presence of both the types of DNR motifs indicating a possibility that these markers would be able to distinguish greater diversity among mulberry accessions. The least abundant DNR motifs found in genomic SSRs was “CA/GT and CG/GC”. The frequency of “GC” repeats was generally less in genomic regions of most plants as reported in peach [31], coffee [32], rubber tree [33], wheat [34] and soybean [35]. While “GAA” repeats were most frequent (15.9%) among the TNRs, “AAAT” repeats were the most frequent tetra nucleotide repeats (16.6%). Similarly, “AAAAC” and “AAAAAG” repeat types were more frequent among the PNR and HNR groups, respectively.
Table 1

Sequences analyzed while developing genomic and genic SSR markers in mulberry

Library

No. of colonies screened

No. of clones sequenced/Transcripts screened

Clones with SSR repeats

Sequences containing more than one SSR

Total no. of repeats

Primers developed

Primers standardized/Locus specific amplification

Genomic

1588

1094

484

234

900

222

137

EST

-

2391

800

254

1155

136

51

Total

3485

1284

488

2055

358

188

Figure 1

Classification and diversity of repeat types among the identified genomic and genic microsatellite motifs. The total number of microsatellite motifs on genomic sequences is illustrated in panel A while the genic microsatellites are in B. The locus specific marker diversity of genomic and genic microsatellites is illustrated in A1 and B1, respectively.

Based on the repeat sequences, the microsatellite regions were classified as perfect, interrupted (more than one of the same repeat motif spaced by a few base pairs) and compound repeats (different repeat motifs occurring tandemly and/or interrupted by a few base pairs). Details about the genomic SSR marker types, their repeat motifs detected in the enrichment library and the gene bank accession number are presented in Table 2. Of the repeat regions identified, 74.5% were perfect, 6.5% were interrupted and 19% were compound repeats. Repeat regions of the “perfect” type are more common in plant genome compared with “interrupted” or “compound” [36, 37]. Though greater representation of compound repeat motifs is not common in plant genomes, they seem to exhibit greater levels of polymorphism and hence have a distinct advantage in mapping and diversity analysis [3841].
Table 2

Details of the genomic SSR markers developed for mulberry

Sl no

Primer name

Primer sequence

GenBank-ID

Amplicon size

Repeat motif

Ta (°C)

Repeat type

1

MulSSRIF

GATCTGAAGTCACCCAGCC

GF101960

236

TC

56.8

Perfect

 

MulSSRIR

GCAGAATCTTTTCAGCTTCCA

     

2

MulSSR2F

GGTGCCTGAAGATATGTGG

BV722881

154

AC

56.8

Perfect

 

MulSSR2R

CTCTGAGGGAAGCAGAAG

     

3

MulSSR23F

CGGAAACAGCCCAAAGAAGG

GF101977

223

AAACCT

56.8

Perfect

 

MulSSR23R

AGGAGGGGTTTAGGGG

     

4

MulSSR26F

CCACTGGTGCCTGAAG

BV722891

282

AC

56.8

Perfect

 

MulSSR26R

CATCTCATACTGGGGC

     

5

MulSSR-82 F

CAATCACTAACGGGGGAAG

BV722895

240

CT

56.8

Perfect

 

MulSSR-82R

GCTCTTTTTGGTGCTCC

     

6

MULSSR59F

GGTTTCATTTTCCCTCTCGA

BV722893

243

TTC

56.8

Perfect

 

MULSSR59R

GGCCGATGCGAACAGA

     

7

MULSSR85F

CCGGAGAAATTCCAAAGG

BV722896

304

TC

56.8

Perfect

 

MULSSR85R

CATCCAGGCATCTGATTG

     

8

MULSSR69F

CAATATTACCACCCTCAC

GF101963

294

TC

56.8

Perfect

 

MULSSR69R

GAAATGGTTTGCATCC

     

9

M2SSR1F

CTCTCGAGAAAGCCATCA

GF107867

217

CA

50

Perfect

 

M2SSR1R

GGTTGTCAAGTAGGACCG

     

10

M2SSR5F

GCTCAGATTCGGTCATGG

GF109684

186

TC

50

Perfect

 

M2SSR5R

CTGCTTCATGGTATCAGAGCAAGG

     

11

M2SSR12F

GCGACCATTCAACAGAACCA

GF107890

270

AG

50

Perfect

 

M2SSR12R

GTGTTGTGGTTACTGGTTCC

     

12

M2SSR13F

GTGTGTTGAGTGTAGCGGC

GF107891

154

GT

58

Perfect

 

M2SSR13R

CGACGAAGATAACGACACGAC

     

13

M2SSR19aF

GAAGAGCTCGCTACAAGG

GF107894

178

TTTTC

51.5

Perfect

 

M2SSR19aR

GAAAGGCATGCTGCTCATG

     

14

M2SSR20F

CTAGAGAATCTTGGGCGATCC

GF107896

230

TC

55

Perfect

 

M2SSR20R

ACCGAGCGCTAGTTGTCAG

     

15

M2SSR21F

GTTGCTGTGTGCTTGTGG

GF107897

247

TG

45

Perfect

 

M2SSR21R

ACACAACACGTCAACCCAGA

     

16

M2SSR53F

GTTGCTGAGCGTGGTGATAG

GF109658

172

AG

50

Perfect

 

M2SSR53R

ACGACACGCACACACGTC

     

17

M2SSR65F

GGCTGATAATCGCAATGC

GF107874

173

AGG

51.5

Perfect

 

M2SSR65R

GCGTGCCCACGTAGGAAG

     

18

M2SSR67F

CGAGAAATTCCGACTCCATGGTC

GF107901

158

CTC

55

Perfect

 

M2SSR67R

CCGGTGGTAGTGTTGCAAGAG

     

19

M2SSR68F

AATTCCGACTCCATGGTCAG

GF107902

211

TCT

51.5

Perfect

 

M2SSR68F

TTCCGGTGGTAGTGTTGC

     

20

M2SSR93F

ATAGCCGATTTTGCAGGC

GF107877

243

CTCC

50

Perfect

 

M2SSR93R

GAAATTCCGACTCCATGGTC

     

21

M2SSR94bF

ATTAGCCGTGCATCTCTGG

GF107909

295

ACTA

55

Perfect

 

M2SSR94bR

CGATCACTTTCATGATCCGGG

     

22

M2SSR102F

GAGCAAGGTTTCTGAACCC

GF107910

203

AAG

51.5

Perfect

 

M2SSR102R

CTCAGCAGTCGTCTGAGG

     

23

M2SSR121F

CGATCTGAAAGATGTCGTGC

GF107913

210

CAC

45

Perfect

 

M2SSR121R

GCAACCGTCGTTCTCAGC

     

24

Mul3SSR1F

CGGAAAGGGTCATGTTG

KF030980

150

AAAT

53

Perfect

 

Mul3SSR1R

CTGTCGTTATTGAGAGAGCAGG

     

25

Mul3SSR2F

GCTAGCAGATCCCACC

KF030981

261

CT, GAGACC

53

Perfect

 

Mul3SSR2R

CAGCTCCTCTTCCACAAGC

     

26

Mul3SSR4F

GGAGCAGTCAATCTCTTG

KF030982

314

(ATATAC)CAC(TA)

50

interrupted

 

Mul3SSR4R

CTGGGGTTCAAACTAAGCTC

     

27

Mul3SSR6F

GAGAGGTCGCCCCTTAG

KF030983

335

GT

51.5

Perfect

 

Mul3SSR6R

GCCTCACAGGAGAACACC

     

28

Mul3SSR7F

CCATGGCTCTTTTGGTC

KF030984

198

CTG

48.5

Perfect

 

Mul3SSR7R

GCAGAATCCAGCTTTTTGG

     

29

Mul3SSR9F

GACCAGCCATGAGCCTAC

KF030985

378

GT, GA

51.5

Compound

 

Mul3SSR9R

GGTTCACAACCACAATCTCC

     

30

Mul3SSR14F

GGCGGTTTAGGAATATAGC

KF030986

227

AG

47.5

Perfect

 

Mul3SSR14R

CCAAAACGAGAAGAACG

     

31

Mul3SSR16F

CTAGTAGCAGATCACCAC

KF030987

207

A, AAAAG

49.5

Compound

 

Mul3SSR16R

CGGTCTCTCCCTAATCC

     

32

Mul3SSR17 F

GTCTTGCACTAGGAGAGG

KF030988

345

GT

50.5

Perfect

 

Mul3SSR17R

CTCACAGGAGAACACCACC

     

33

Mul3SSR19F

CCAAGTCCTCCTCCAG

KF030989

172

GAA

50

Perfect

 

Mul3SSR19R

GTTTTGTGACTTGCCG

     

34

Mul3SSR20F

CTAGCAGATCGTGGCATTG

KF030990

252

(CT)TTCTCTAT(CT)

51

interrupted

 

Mul3SSR20R

CTCCGCCCAAAATATCACAC

     

35

Mul3SSR21F

CATCGCAAATAGGTGTGG

KF030991

239

TC

52.5

Perfect

 

Mul3SSR21R

GGCAGTGAGAGCAAGGAG

     

36

Mul3SSR23F

GCTAGCAGATCCCAAG

KF030992

224

TGCCAC, TCT

53.5

Compound

 

Mul3SSR23R

CGAAACCCGCATTCATTC

     

37

Mul3SSR24F

GCTCTTGTTGACACTGGC

KF030993

225

TC

51

Perfect

 

Mul3SSR24R

CCGATTGTTTAAGGCC

     

38

Mul3SSR25F

GAGCCTTGTTCACCAC

KF030994

155

AAG

50

Perfect

 

Mul3SSR25R

GGTCAACTTTCATGCC

     

39

Mul3SSR26F

GGTATGAGAGCTTCGCAC

KF030995

202

(TC)G(TC)

52

interrupted

 

Mul3SSR26R

GTCTCGGGAACAACAGC

     

40

Mul3SSR28F

GGATCTTGCCATCTAGTGTG

KF030996

112

TA,TG

53.5

Compound

 

Mul3SSR28R

GCAGAATCATAGAGGACC

     

41

Mul3SSR31F

GATCCACTTCCACTCCCAG

KF030997

382

GTC, TTC

52

Compound

 

Mul3SSR31R

GGACGCATGAGGTTTTAGG

     

42

Mul3SSR33F

CTCCCGGATAAAAGACAACC

KF030998

390

GAA

48.5

Perfect

 

Mul3SSR33R

CCTTGCTCATCATCATCG

     

43

Mul3SSR34F

CATTTTCCTCCTGACC

KF030999

221

GA

53

Perfect

 

Mul3SSR34R

CAGTCCACGTCAGTTTC

     

44

Mul3SSR36F

GCAGAATCCCGGAGAAGAG

KF031000

329

GAA

53

Perfect

 

Mul3SSR36R

GCAGAATCCCCTGTTTGG

     

45

Mul3SSR41F

CATCGCTCGTTTTCGCATC

KF031001

251

CTT

49

Perfect

 

Mul3SSR41R

CACTAGCCCCTGCACC

     

46

Mul3SSR43F

CTCTGGAGTACAAGAACCG

KF031002

345

GAA

49.5

Perfect

 

Mul3SSR43R

GGCACGATCCCAATCAAG

     

47

Mul3SSR44F

CGCGTATTTCGGATTTCC

KF031003

238

CT, CA

52

Compound

 

Mul3SSR44R

GCTAGCAGAATCCCATC

     

48

Mul3SSR49F

CAACATCAACACCGATCACC

KF031004

140

TCA

52

Perfect

 

Mul3SSR49R

GCAGAATCCCACCAACATC

     

49

Mul3SSR50F

CTAGCAGATCCACCAAACC

KF031005

161

CTT

53

Perfect

 

Mul3SSR50R

GTTGTTGTACTCTCGCACG

     

50

Mul3SSR52F

CAGATCCCATACACAAAGCC

KF031006

391

TTTTTC

51.5

interrupted

 

Mul3SSR52R

GTGAGAGAACCCGAGAAG

     

51

Mul3SSR53F

CAGCTATGACCATGATTACGCC

KF031007

124

AAAAC

50.5

Perfect

 

Mul3SSR53R

GGACCCTTGATGGCATTG

     

52

Mul3SSR64F

GACGAAAACCGATGAAGAGG

KC408230

380

ATGAGC

47.9

Perfect

 

Mul3SSR64R

GACCGGTAAAACCACACACC

     

53

Mul3SSR65F

CTGGAGTACAAGAACCGCAAC

KC408231

220

GAA

53.8

Perfect

 

Mul3SSR65R

GCCCTCCACCATTGAACTAAG

     

54

Mul3SSR66F

GCGAATGATGAAAACGGAGAGG

KC408232

262

TTTTA

52.8

Perfect

 

Mul3SSR66R

GCGGTTAGTTGCCTAGTTGG

     

55

Mul3SSR67F

ATACCACGTTCCGGTGTG

KC408233

304

GT, GA

52.8

Compound

 

Mul3SSR67R

CATACCGTGCCCCAACTTAC

     

56

Mul3SSR70F

GAAGAGGGGAGAGGGAGAGA

KC408236

187

AAATAA

54.1

Perfect

 

Mul3SSR70R

CAACCAGGATCCAAATAGAAGC

     

57

Mul3SSR71F

GGATACTACCTGTTTGGTTGCTG

KC408237

360

AAAT, GAA

54.5

Compound

 

Mul3SSR71R

ATTCCCTCCTCAACGAC

     

58

Mul3SSR72F

CATCCTTCGAATCCAAGAGC

KC408238

231

(AG)TTTACCCAAAGAAT(AG)

50.8

interrupted

 

Mul3SSR72R

CGAGAGGAAATCCTCACAGC

     

59

Mul3SSR73F

GGGGAGGTAGCTGATGTGTC

KC408239

318

TA, TATT

49.1

Compound

 

Mul3SSR73R

AGCATGCCCTTCCATATCAC

     

60

Mul3SSR74F

CCCATTGAGGGTTTTGTGAG

KC408240

407

AG, GTGAGC

54.8

Compound

 

Mul3SSR74R

ATGTGAGCTCGGGATTTGAC

     

61

Mul3SSR75F

CAGGTTGAACGCCCATTACTC

KC408241

102

CT, TCA, TC

47.9

compound

 

Mul3SSR75R

GTGCAGAATGTCAGTATGCG

     

62

Mul3SSR77F

ACTCCGCCTGAAGAACGAAG

KC408243

254

AGA

54.8

Perfect

 

Mul3SSR77R

TAGCAGAATCCCCTGTTTGG

     

63

Mul3SSR80F

GAGCCGTTTGATTTCCGTC

KC408245

158

CT

47.9

Perfect

 

Mul3SSR80R

CAACGGTCGGTGAAAAAGC

     

64

Mul3SSR91F

CATGAACCGTTGGATCACAG

KC408246

277

AG

54.8

Perfect

 

Mul3SSR91R

ATCCCAGATCCCAAATACCC

     

65

Mul3SSR93F

CAGCCAATGCACTTTTAACG

KC408248

343

AC

49.1

Perfect

 

Mul3SSR93R

GTGGAGCTTCTGTTGAGC

     

66

Mul3SSR94F

CCCTCATGTGTTCCATCTACC

KC408249

198

AAAACAA

52.8

perfect

 

Mul3SSR94R

CAGAATCACAGCCGAGGAAG

     

67

Mul3SSR95F

GATCATCGTGCCAATAAGCC

KC408250

209

AG

52.8

perfect

 

Mul3SSR95R

TAAGAGCTGAGAGGGGAAGC

     

68

Mul3SSR97F

TCCACCACTGAACCAAATC

KC408358

292

GAA

50.8

Perfect

 

Mul3SSR97R

ATTAGGGTTGTGACGACGAC

     

69

Mul3SSR98F

ACGACAATGCTGTCGTCTTG

KC408252

286

TG

55.2

Perfect

 

Mul3SSR98R

CGATTCGGAAAGCAAACCAAAC

     

70

Mul3SSR99F

AGGCAAAGGAGCAGGATG

KC408253

272

TTC

58.5

perfect

 

Mul3SSR99R

GTGGTCACTGCAAAAAGC

     

71

Mul3SSR101F

TGAGCCAAGACAAGGAGACA

KC408255

330

AC

50.8

Perfect

 

Mul3SSR101R

AGCTAGCAGAATCCCCTTGA

     

72

Mul3SSR102F

TTGGTTGCTGAGAAATGCAG

KC408256

230

AAAT, GAA

55.4

Compound

 

Mul3SSR102R

TTGTCGATGGAAAACACGAC

     

73

Mul3SSR103F

GGTCAGATCAGTTTCGTTGC

KC408257

258

AG

53.3

Perfect

 

Mul3SSR103R

GTAAGAGCTGAGAGGGGAAG

     

74

Mul3SSR104F

GAAGAGCCGACAAAGAATGG

KC408258

225

ATGAGC, GCAGAGAA

53.3

Compound

 

Mul3SSR104R

GGAATGCTTGACCTTTGACC

     

75

Mul3SSR105F

GCAGAATCCCAAGTTAATGCC

KC408259

254

TCT, TGCCAC

57.1

Compound

 

Mul3SSR105R

CCTCATAGAGTACAGGAACCG

     

76

Mul3SSR108F

TCTGCCATGGATGCGTGC

KC408262

215

CCTCT, TC, TC

54.1

Compound

 

Mul3SSR108R

GACAGAAACCCGGCAGAAG

     

77

Mul3SSR114F

GCAACTCTGCCTTGTTTTC

KC408266

106

AG

58.5

Perfect

 

Mul3SSR114R

TGGTGCCTTAGACCAGAC

     

78

Mul3SSR116F

GATTTTCAGCGCATGGTTC

KC408267

382

TTTTA, AATA

58.5

Compound

 

Mul3SSR116R

CCAAGGAAGGTGAAATCC

     

79

Mul3SSR118F

CATGAACCGTTGGATCACAG

KC408269

277

AG

53.3

Perfect

 

Mul3SSR118R

ATCCCAGATCCCAAATACCC

     

80

Mul3SSR122F

GGTGATGGGCTTTTGATG

KC408273

219

ATC

51.7

Perfect

 

Mul3SSR122R

GTTGGATCTGAGGAGGGTC

     

81

Mul3SSR124F

GGGTGCCAAGGAAAGGA

KC408275

228

TCTTTC

54.8

Perfect

 

Mul3SSR124R

AGAGAGATTCGGCAAAACC

     

82

Mul3SSR125F

CTTTGATGATGCTTCCTCTGC

KC408276

261

CTT, CTA

54.1

Compound

 

Mul3SSR125R

GTGCACGGAATTTGCTACTG

     

83

Mul3SSR126F

GGATGCTATTGCCTAAAGTG

KC408277

199

AAAAG, AAAAGA

52.8

Compound

 

Mul3SSR126R

GCAGAATCAGAAGTGTTGTCC

     

84

Mul3SSR127F

CGATTGCCACATGTTCAGAC

KC408278

309

AC

52.8

Perfect

 

Mul3SSR127R

GGCAGACCCGATAAGCAGTA

     

85

Mul3SSR131F

ACTGTGCTTCGTGGAGTTG

KC408279

305

CT, TCA

55.4

Compound

 

Mul3SSR131R

GAGAGCTTCGAGAGGGAGG

     

86

Mul3SSR135F

GATCATCACAAAAAGGCTGG

KC408282

137

TC

55.4

Perfect

 

Mul3SSR135R

GATTGCCGACACTCGTATC

     

87

Mul3SSR141F

TTGGTGCACTTGCCAAAC

KC408286

336

TTTGTT, T

52.8

Compound

 

Mul3SSR141R

TCACCTCGCATAGACCAC

     

88

Mul3SSR142F

GCAGAATCCCAAACTTGAGAG

KC408287

213

(AG)AAGCTGAAAATGGGGTGT(AG)

54.5

interrupted

 

Mul3SSR142R

CACAGTTAGCATCACCATGTC

     

89

Mul3SSR143F

TGCCACCTTCTCCAATATG

KC408288

151

TTA

54.5

Perfect

 

Mul3SSR143R

CGGGAATCGGGATTAAG

     

90

Mul3SSR144F

GATATGGGAACAAGGGCACTG

KC408289

284

CATCAC, ACT

54.5

Compound

 

Mul3SSR144R

CTGTTTGATGAAGCCATGATG

     

91

Mul3SSR145F

CCTTCTTCCCCATACCCAC

KC408290

165

TCA

50.4

perfect

 

Mul3SSR145R

CATTTCGGAAGCTTGTCCA

     

92

Mul3SSR146F

CAACCGATTACATGGTGTGG

KC408291

256

CT

50.4

perfect

 

Mul3SSR146R

TTCCGCAGCAAGCTTTAC

     

93

Mul3SSR148F

AGGCAATGACAAACGGAAG

KC408293

156

CAA

45.1

Perfect

 

Mul3SSR148R

GCAACCACTTCTGTGTGAGC

     

94

Mul3SSR149F

TGTCTCTTGGTCAGCGTCTC

KC408294

280

(AC)TATACATTCGT(AC)

54.8

interrupted

 

Mul3SSR149R

CATTTCCCAGAAAGCCACTTC

     

95

Mul3SSR150F

TCCTGTCTTAGATCGCAACG

KC408295

226

TTTTA, AAG

54.8

Compound

 

Mul3SSR150R

GGTGGCAGGGATTAATGAG

     

96

Mul3SSR151F

GAGTTTGCAGCCTCAGTATGG

KC408296

196

GT, T

54.8

Compound

 

Mul3SSR151R

CGTGCTTGGAGTAAGGGAAG

     

97

Mul3SSR152F

TCTCTGTCTGCGCATCAATC

KC408297

189

TC

54.5

Perfect

 

Mul3SSR152R

GCAGAATCCCGATTTTACAG

     

98

Mul3SSR153F

GGGCATTGTATTGTCCAAGC

KC408298

302

TTA

51.7

Perfect

 

Mul3SSR153R

GAGTAGCCGACATAAATCAGC

     

99

Mul3SSR155F

ACCCTAAATTGGGACGGAAG

KC408300

105

AAG

54.5

Perfect

 

Mul3SSR155R

CGATTTCTACGAATGCCAGAC

     

100

Mul3SSR156F

CCCACCCAATCACAATAACC

KC408301

190

GAA

 

Perfect

 

Mul3SSR156R

GTCAACTCCCGAGCTCAC

     

101

Mul3SSR159F

CCCAGTTGGGGTTGAGTTG

KC408304

108

TTC

51.7

Perfect

 

Mul3SSR159R

CCTGTCTTGGAGAGGAGAAC

     

102

Mul3SSR160F

CCCTCTCTCTCGTCGTTCTC

KC408305

171

CTT

54.8

Perfect

 

Mul3SSR160R

CCCACTCAACCCGTTTTATG

     

103

Mul3SSR161F

TGCATGTACTGGATGATGTG

KC408306

166

TGAAG

54.8

Perfect

 

Mul3SSR161R

CTTTGGCTGTAGAAGCACG

     

104

Mul3SSR163F

CAGATCTTCTCTCTTGCTCC

KC408308

221

CT, CA

54.5

Compound

 

Mul3SSR163R

GTATGTTTGCTTCACGGCTC

     

105

Mul3SSR164F

CGGCGGTGGAGAAACAAAG

KC408309

393

GA, AAAG, AAAAAG

54.8

Compound

 

Mul3SSR164R

GTGAACCCCTGTCTTGGATG

     

106

Mul3SSR166F

AAGAGAACAGTGGCCGTC

KC408311

222

ATCACC

54.8

Perfect

 

Mul3SSR166R

AGGGAAAGGCAAGACTAGGG

     

107

Mul3SSR167F

CCTTCTTCCCCATACCCAC

KC408312

190

TCA

49.1

Perfect

 

Mul3SSR167R

CACATTTCGGAAGCTTGTCC

     

108

Mul3SSR168F

CCCTTTAATCCTCTGCCTG

KC408313

267

AC

50.4

Perfect

 

Mul3SSR168R

GCTGATACTTGGGGTTGG

     

109

Mul3SSR169F

CCAGTTGGGGTTGAGTTGTAAC

KC408314

107

TTC

54.8

Perfect

 

Mul3SSR169R

CCTGTCTTGGAGAGGAGAACC

     

110

Mul3SSR170F

TAGCTAGCAGATCCCTAC

KC408315

241

GT

49.1

Perfect

 

Mul3SSR170R

GGATTTCGTCGCAACCAT

     

111

Mul3SSR171F

GGAGGGGTTTTCCTTGAC

KC408316

168

GAA

51.7

Perfect

 

Mul3SSR171R

CGAAGTGGTGCTCTTCAC

     

112

Mul3SSR172F

GCTAGGCTAAAGCCTGGAAG

KC408317

140

TGGATA

54.5

Perfect

 

Mul3SSR172R

TAGTTCCGGTGACCAACTCC

     

113

Mul3SSR173F

TCCCGGAACAATCTTATGG

KC408318

304

CTT, CTA

54.5

Compound

 

Mul3SSR173R

CCCTAGTGCACCTTCATTTC

     

114

Mul3SSR174F

AGCGGTTTCTTGTGAGCAG

KC408319

371

A, TTC

54.8

Perfect

 

Mul3SSR174R

CATAGTTTGGGCCCGTTTAG

     

115

Mul3SSR175F

GGAAAAGAAAGGGGGAATCAG

KC408320

127

GT

54.8

Perfect

 

Mul3SSR175R

GTCTCCTTTTGGGGATACCA

     

116

Mul3SSR177F

CACGTACGCAACTTTTTCC

KC408322

329

AG

49.1

Perfect

 

Mul3SSR177R

GTGAGGCTTGACCTGAATG

     

117

Mul3SSR178F

CAGAGGAGGATATGACATTATCAAC

KC408323

202

TC

49.1

Perfect

 

Mul3SSR178R

CAAACAGAATCCCACACACG

     

118

Mul3SSR179F

CCAGTTGGGGTTGAGTTGTAAC

KC408324

107

TTC

50.4

Perfect

 

Mul3SSR179R

CCTGTCTTGGAGAGGAGAACC

     

119

Mul3SSR180F

TCGCCACAATCTTTCACTTG

KC408325

335

TCA, TCT

54.8

Compound

 

Mul3SSR180R

GCGGAGGAATTTTCCATC

     

120

Mul3SSR181F

CTCTGACATTGGCAAGAAAGC

KC408326

282

TTC

51.7

Perfect

 

Mul3SSR181R

GAGGAACGGCAATAAGAGG

     

121

Mul3SSR183F

GATCAGGAGAGGAAGGAG

JX258829

150

AGA

52.8

Perfect

 

Mul3SSR183R

CTGTCAAAACCAGCCTTG

     

122

Mul3SSR184F

CATTCCTGGTGTCAGCCT

JX258830

163

(TC)T(TC)

51.7

interrupted

 

Mul3SSR184R

CAGATCGGCACCAATAGT

     

123

Mul3SSR185F

AGAGAGCAACCACGGGAAG

JX465665

336

AAAAAG

52.8

Perfect

 

Mul3SSR185R

GTGAACCCCTGTCTTGGA

     

124

Mul3SSR187F

GGACATTTCACAACCCTG

JX465667

324

AAT, CT, AGA

53.8

Compound

 

Mul3SSR187R

AACTGCAAGTTGGCACAG

     

125

Mul3SSR190F

AGCTGGGTGGAGGATTG

JX465669

283

AC, GCAC

54.8

Compound

 

Mul3SSR190R

CCACCTCTGCAAGGATTG

     

126

Mul3SSR191F

CGAATGCATAGAGGGAGAGC

JX465670

386

AAAAC

50.4

Perfect

 

Mul3SSR191R

CACTTGAGGGTTCATTCAGC

     

127

Mul3SSR192F

GACCTACTTCTCGAACAGTAAC

JX465671

198

AAAAC

54.8

Perfect

 

Mul3SSR192R

CTTGAGGGTTCATTCAGC

     

128

Mul3SSR193F

GCTAGTTCCATCGCCCATAG

JX465672

358

TTGA, TG

51.7

Compound

 

Mul3SSR193R

GCATCAGATAAAGCAGGTG

     

129

Mul3SSR197F

GGTGAAAGTTCGTGTGAGTCC

JX465674

186

TCT, TC

54.8

Compound

 

Mul3SSR197R

TCAGCAACTAGAGTGACTTTG

     

130

Mul3SSR199F

CTCAGGTACGCTGTGCTG

JX465675

238

TC

54.8

Perfect

 

Mul3SSR199R

GACTCAAAGCACATGCCAAG

     

131

Mul3SSR201F

CCATTGAGGGTTTTGTGAG

JX465677

406

GA, GTGAGC

54.8

Compound

 

Mul3SSR201R

ATGTGAGCTCGGGATTTGAC

     

132

Mul3SSR202F

CCCTCTCGATCATCACC

KC408332

230

TTC

49.1

Compound

 

Mul3SSR202R

CGGAGACGTAGATGCCC

     

133

Mul3SSR203F

GACCGTAGGAGAGAGTGC

KC408333

442

T, G, CG

54.8

Compound

 

Mul3SSR203R

GGATACCCGCTAAACCCAC

     

134

Mul3SSR205F

GCAGTTCCGAATCACGAAATAGG

KC408335

216

TTTA

49.1

Perfect

 

Mul3SSR205R

CAAGGCGAGGTAAACACC

     

135

Mul3SSR214F

GTGGAACAGGGAGCCAGTCT

KC408344

297

GGGCG, GAG, GAGGA

54.8

Compound

 

Mul3SSR214R

CATGCACGTCTCACTCCAC

     

136

Mul3SSR229F

CCTTATAGCCGATTTTGCAGGC

KC408354

247

TCT

54.8

Perfect

 

Mul3SSR229R

GAAATTCCGACTCCATGGTC

     

137

Mul3SSR230F

CGGGTGAGCTGGTTTGTTTC

KC408355

298

GT, TG

50.4

Compound

 

Mul3SSR230R

CAGCCCCACAATCCCTACT

     

Development of genomic SSR markers

Although DNA sequences harboring microsatellite regions were captured using specific probes, primers could not be designed to all the sequences. In instances where the repeat stretch was less than 15 nucleotides or in situations where the repeat regions were close to the ends of the sequences, primers were not designed. Thus, out of the 1094 genomic clones sequenced, 222 primer pairs could be developed (Table 1). The web-based program, Primer3 (http://bioinfo.ebc.ee/mprimer3/), was adopted to design primers to the identified regions with more than 15 nucleotide repeats so as to amplify at least 150 bp fragments. The pre-cloning enrichment strategy captured specific genomic regions that were complementary to the microsatellite probes used. Thus, this approach enhanced the success of identifying specific loci that were unique in the genome. Of the set of 222 primer pairs developed, 137 (61.71%) showed locus specific amplification reiterating the advantages of the pre-cloning enrichment strategy in discovering microsatellite regions [17, 30, 42, 43]. These locus specific markers detected 232 microsatellite motifs that could be classified into interrupted and compound repeat types (Table 2). Of these repeat types, 86 (37.1%) were DNR, 73 (31.5%) TNR, 19 (8.2%) TtNR, 27 (11.6%) PNR and 27 (11.6%) were HNR types (Figure 1). These genomic SSR markers developed for mulberry have been deposited in the NCBI GenBank database and the details of all the locus specific primers are given in Table 2.

Isolation and characterization of genic microsatellites

A set of 2391 stress specific EST sequences obtained by subjecting K2, a leading mulberry variety [1921], was examined for the presence of repeat motifs and 800 sequences were found to contain a total of 1155 genic microsatellite regions (Table 1). Of these, 254 sequences were found to contain more than one microsatellite locus. Mono nucleotide repeats were the most common among the sequences (Figure 1) followed by tri and hexa-repeat motifs (28.3% and 38.3% respectively). Among the factors that cause the generation of repeat sequences in the genome, replication slippage is often considered as the major mechanism. Though, this is a random phenomenon, the slippage in genic regions occurs in repeats of three bases clubbed with frame shift mutations which suppresses non-triplet repeats resulting in the abundance of TNR and HNR motifs [4446]. A total of 180 compatible microsatellite regions were identified represented by 136 primer pairs (Figure 1). A significant 87.5% of these were perfect while 5.8% were interrupted and 6.6% were compound repeats (Table 3).
Table 3

Details of the genic (EST) SSR markers developed for mulberry

Sl no

Primer name

Primer sequence

GenBank-ID

Amplicon size

Repeat motif

Ta (0°C)

Repeat type

1

MESTSSR10F

CATTGCACATTGCAGGTAGC

GT629469.1

237

GTT

52.8

Perfect

 

MESTSSR10R

CGGCCATCCAAAATGTTGTTC

     

2

MESTSSR13F

TCTATCTCAACCGGAAGTCC

GT628644.1

230

(CAAAAG)G(AAAATA)

54.8

interrupted

 

MESTSSR13R

CCAATTTGCTCGTCTTATGC

     

3

MESTSSR14F

CGGCCACAGGTACTTTC

GT628768.1

202

TTGATT

50.4

Perfect

 

MESTSSR14R

GGCAGCGATTTAGGATTGG

     

4

MESTSSR20F

CGCAAGTGTCTCAACTG

GT629110.1

200

TGA

49.1

Perfect

 

MESTSSR20R

GGAACGGATGGAGTAAG

     

5

MESTSSR23F

GGCCCAAACTCCATAGC

ES448350.1

202

TAC

50.4

Perfect

 

MESTSSR23R

CCGCCAATTCTAGACCAATG

     

6

MESTSSR26F

CGTGATTACCTTCGGATTGG

ES448391.1

219

AGCTGG

57.9

Perfect

 

MESTSSR26R

CCAACCCAGTAGACCCAGTG

     

7

MESTSSR27F

CCAACATTATCCGGAACACC

ES448394.1

266

CGG

54.8

Perfect

 

MESTSSR27R

GGTAAAGCCATCCGTTGC

     

8

MESTSSR28F

GCCCAGTTTCCCACAGAA

ES448403.1

217

ATA

47.9

Perfect

 

MESTSSR28R

GGATGGTTTGTGCGTGC

     

9

MESTSSR31F

CACCAATTAAAAGCGCAGTG

ES448813.1

204

GA

57.9

Perfect

 

MESTSSR31R

CTTTGTGGTTGGCTCGTG

     

10

MESTSSR35F

CGTTTTCCGCTTCAGAGAG

ES448478.1

206

AG

54.8

Perfect

 

MESTSSR35R

GCCGATATCCTCCTTTCCTC

     

11

MESTSSR37F

CAAAAGCGGTTTGGAATAGC

ES448476.1

245

(CTTTC) CTCC(T)

54.8

interrupted

 

MESTSSR37R

CCTCAACACAAAACCCACC

     

12

MESTSSR40F

GAATCCTACAAGGGAGC

ES449069.1

215

AAAAT

52.8

Perfect

 

MESTSSR40R

CATACAAGGATGCCCACC

     

13

MESTSSR41F

GGTCGACAAGAGGTAATC

ES449022.1

121

AAAAG

56.7

Perfect

 

MESTSSR41R

GAAGGCACCGAAGAGAAC

     

14

MESTSSR42F

CAAGAGGTAATCCGTTC

ES448502.1

254

AG

54.8

Perfect

 

MESTSSR42R

CGTTGTTAGCAGGAGC

     

15

MESTSSR46F

GCCCATGTTTGCGGAG

ES449184.1

200

AG

56.7

Perfect

 

MESTSSR46R

GGATTTTTCTGTCTGGGTG

     

16

MESTSSR47F

GACTGCGGGAGAACAG

ES448510.1

220

CTC

54.8

Perfect

 

MESTSSR47R

GTTCACCGAGGCTGAGAG

     

17

MESTSSR48F

GTTGTGGTGGTTGTTGC

ES448516.1

201

TC

56.7

Perfect

 

MESTSSR48R

CCTTCACTTTCTCGCC

     

18

MESTSSR49F

CTTCGACGCCTTCTGCG

ES448598.1

184

GAAGA

56.7

Perfect

 

MESTSSR49R

GAGCGTCTCGAAGCAGTTG

     

19

MESTSSR50F

GCCGGCATGTACGGATA

ES448967.1

235

CCTAAC

54.8

Perfect

 

MESTSSR50R

GTAAAAGTTTCGCCCCAGG

     

20

MESTSSR51F

CCTAGGGTTTCCTTCGCTTC

ES448621.1

223

GCG

54.8

Perfect

 

MESTSSR51R

CGCTTAGGCTCCTTCCTC

     

21

MESTSSR52F

CTTCGTTACGCTCGCTATG

ES448640.1

261

TATTTT

56.7

Perfect

 

MESTSSR52R

CCTTCTCTCAAGAATACTGG

     

22

MESTSSR53F

GGCCAACATGTACGGATAG

ES449078.1

203

CCTAAC

56.7

Perfect

 

MESTSSR53R

CGCCAGGTACAACAAGAAG

     

23

MESTSSR56F

CATTGCGTTCCTTGAG

ES448442.1

220

ATCATG

58.8

Perfect

 

MESTSSR56R

GGAGCCAAGACTCCTAAG

     

24

MESTSSR59F

GAGCTCCGACGACCAC

ES448462.1

236

TCATGA

54.8

Perfect

 

MESTSSR59R

GCGTCTCGACGTGAGAAATAAC

     

25

MESTSSR61F

CCATAGCCTCAACGTTTC

ES448534.1

239

AAAAAC

54.8

Perfect

 

MESTSSR61R

CGCTCACGTCCGTATC

     

26

MESTSSR66F

GGAAAATTCATCCCCCAAGC

ES448761.1

258

TTTTTG

53.8

Perfect

 

MESTSSR66R

CGATGAGAAGCTCAAGGAG

     

27

MESTSSR67F

GTGCTCGTAGCTTTGATGG

ES448763.1

215

ATCGCC

54.8

Perfect

 

MESTSSR67R

GCGAAGGAGAAGGAGGAGAG

     

28

MESTSSR73F

CTCAAGCTATGCATCCAACGC

ES448909.1

237

CT

52.8

Perfect

 

MESTSSR73R

CCACTTCGAGAGCTTCG

     

29

MESTSSR74F

CCATGGCTGAGCACGAG

ES448909.1

238

GAA, GAG

52.8

compound

 

MESTSSR74R

GAGCTCCAGTGTTCCTC

     

30

MESTSSR76F

GATCCAGAACTCCCAAACC

ES448912.1

209

CTCCGT

50.4

Perfect

 

MESTSSR76R

GGTAATCCGAGTTCGAGACG

     

31

MESTSSR77F

CCATAGCCTCAACGTTTC

ES448915.1

238

AAAAAC

52.8

Perfect

 

MESTSSR77R

CGCTCACGTCCGTATC

     

32

MESTSSR78F

GCACTCTCAAACAAATCCTC

ES448921.1

242

AAGTGG

52.8

Perfect

 

MESTSSR78R

CGTTTGGAAACGGCTACTTC

     

33

MESTSSR79F

CCCATAGCCTCAACGTTTC

ES448926.1

221

AAAAAC

45.9

Perfect

 

MESTSSR79R

CGACAACAACCGTCAAGTC

     

34

MESTSSR85F

GTCATCTATGTCGGGTGGTC

ES448670.1

310

ATACAT

55.4

Perfect

 

MESTSSR85R

CATGGAGCGTTTGTTGTGTG

     

35

MESTSSR99F

GGCCAACATGTACGGATAG

ES448967.1

203

CCTAAC

50.4

Perfect

 

MESTSSR99R

CGCCAGGTACAACAAGAAG

     

36

MESTSSR108F

GGCTCTGAATGTCCGAGAAG

ES448289.1

246

GAGTTG

50.4

Perfect

 

MESTSSR108R

GGGTGGTAGATTTGGCAC

     

37

MESTSSR109F

CTCACGTCCGTATCATCG

ES448314.1

244

TTTGTT

50.4

Perfect

 

MESTSSR109R

CCATTCCCATAGCCTCAAC

     

38

MESTSSR111F

CATCTATGTCGGGTGGTCG

ES449122.1

299

AAAT

45.9

Perfect

 

MESTSSR111R

CTATGCACAACAGGCTGC

     

39

MESTSSR113F

GCCTCCCATTATGCACTATG

ES449132.1

206

AAAACA

52.8

Perfect

 

MESTSSR113R

CGGATCTTCCAGGCTC

     

40

MESTSSR115F

CAGGAATCAGAGCCAGAGC

ES448647.1

398

AAAAAC

53.8

Perfect

 

MESTSSR115R

CTGGACCATGTGGAAGC

     

41

MESTSSR117F

CATTATCCGGAACACCAGACG

ES448396.1

247

CGG

53.8

Perfect

 

MESTSSR117R

GCTAAGAACCTCGCTCG

     

42

MESTSSR121F

CACGTCCGTATCATCGG

ES449197.1

244

TTTGTT

52.8

Perfect

 

MESTSSR121R

CCATTCCCATAGCCTCAAC

     

43

MESTSSR129F

GATTACTCCAACCAACTCC

ES449040.1

223

AAAACC

52.8

Perfect

 

MESTSSR129R

CAAGGGGGCTAGGAAG

     

44

MESTSSR123F

CATCTATGTCGGGTGGTCG

ES448449.1

240

CT

52.8

Perfect

 

MESTSSR123R

GTGTTTGCTGGACTTTGC

     

45

MESTSSR126F

CACCGATGAGCCCTGGTC

ES448693.1

200

TTC

52.8

Perfect

 

MESTSSR126R

GCACAATCCATCCCAAGTG

     

46

MESTSSR127F

CCAACATTATCCGGAACACC

ES448594.1

285

CGG

52.8

Perfect

 

MESTSSR127R

CCTGGACGGAAGAAGTGG

     

47

MESTSSR131F

CCTCATTGCGTTCCTTGAG

ES448442.1

225

ATA, ATCATG

54.1

compound

 

MESTSSR131R

CTGATTTGGGAGCCAAGAC

     

48

MESTSSR132F

CTATGTCGGGTGGTCG

GT735086.1

473

TTTTCC

54.1

Perfect

 

MESTSSR132R

CATACCGTCGGAGATGC

     

49

MESTSSR136F

CCATTCCCATAGCCTC

ES449178.1

244

AAAAAC

50.5

Perfect

 

MESTSSR136R

CGTCCGTATCATCGG

     

50

MESTSSR134F

GGTTGTTGTCGAATCCG

ES448600.1

208

TTTGTT

55.4

Perfect

 

MESTSSR134R

GTACAAACCGAACGGGAAC

     

51

MESTSSR135F

CCTCATTGCGTTCCTTG

ES448442.1

219

ATCATG

54.1

Perfect

 

MESTSSR135R

CCGGTGAGGTGATTGG

     

It appears that the forces causing tandem repeats such as mutation, replication slippage etc., occurred more frequently in non-coding regions than the genic regions [22, 45, 47]. It is also possible that the lethal mutations in genic regions would subsequently eliminate the genotype while the sequence variations in non-coding regions of the genome would persist, resulting in the observation of higher frequency of sequence variations in the non-coding genomic regions. Accordingly, more numbers of repeat regions were found on the genomic regions (82%) while 48% were found in the genic regions. A large number of clones with more than 15bp of repeat motifs were found among the markers developed. Results revealed that the frequency of such markers was more in the non-coding regions of the mulberry genome than the genic regions [25]. The presence of longer repeats in the genome may have an evolutionary advantage leading to differences in the ability to adapt to new environments [48, 49].

Validation of genomic and genic SSR markers

The genic and genomic SSR markers were validated using four contrasting genotypes of Morus alba that were chosen based on variations in certain physiological traits [50] and seven different mulberry species (all belonging to the genus Morus) (Table 4). Of the 222 genomic and 136 genic SSR markers screened, 137 (62%) genomic and 51 (37%) genic SSR markers showed single locus amplification in all the Morus species as well as genotypes of Morus alba (Table 5). Further, genomic SSRs exhibited greater levels of polymorphism compared with the genic SSR markers. Such phenomenon has also been reported in other plant species [51]. Of the 188 markers examined, 87 (46.2%) detected heterozygosity in the mulberry genotypes and species with a maximum of 1.00 for markers MulSSR39, Mul3SSR26 Mul3SSR91 and Mul3SSR135, (Additional file 1). Around 41% of the genic markers also detected heterozygosity among the mulberry genotypes and species (Additional file 1). SSR markers are highly suited for mapping even in cross pollinated species because of their ability to detect heterozygosity. The markers developed in this study also detected significant levels of heterozygosity in mulberry species and genotypes.
Table 4

Various mulberry species (A), mulberry genotypes (B) and other related species (C) for characterizing SSR markers

S.No

Genotypes

Family

Origin

Ploidy

 

1

M. alba

Moraceae

Japan

2n = 28

A

2

M. assambola

Moraceae

-

-

3

M. exotica

Moraceae

Zimbabwe

-

4

M. indica

Moraceae

India

2n = 28

5

M. lavigata

Moraceae

India

2n = 3× = 42

6

M. macroura

Moraceae

-

-

7

M. multicaulis

Moraceae

China

2n = 28

8

Dudia white

Moraceae

India

-

B

9

Himachal Local

Moraceae

India

-

10

MS3

Moraceae

India

-

11

UP105

Moraceae

India

-

12

Artocarpus heterophyllus (Jackfruit)

Moraceae

Asia

2n = 56

C

13

Ficus bengalensis (Banyan)

Moraceae

South Asia

-

14

Ficus carica (Fig)

Moraceae

South Asia

2n = 26

(Note: All species belong to family Moraceae).

Table 5

Markers developed for mulberry and their transferability to related species

SSR type

Locus specific

Monomorpic in Morusspp

Monomorpic in all species

Polymorphic in Morusspp

Primers transferable to other species

Transferability

Jackfruit

Ficus

Fig

Genomic

137

12

1

125 (91.24%)

107 (78.10%)

96 (70.07%)

64 (46.71%)

64 (46.71%)

Genic

51

12

6

39 (76.47%)

42 (82.35%)

39 (76.47%)

21 (41.17%)

22 (43.13%)

Total

188

24

7

164 (87.23%)

149 (79.25%)

135 (71.80%)

85 (45.21%)

86 (45.74%)

Variations in the genic regions, though less frequent, would have a greater possibility of having a direct role in altering the phenotype of an organism [52]. The variability obtained for the SSR markers across mulberry species and genotypes was analyzed using Power Marker version 3.25 and the results are summarized in Table 6. A total of 936 alleles were obtained from 188 markers of which 164 (87%) were polymorphic among the mulberry species and genotypes. These markers revealed an allelic diversity ranging from 1 to 17 with an average of 4.97 alleles per marker locus (Figure 2/Table 6). Earlier reports on allelic diversity of mulberry SSR markers had revealed an average of 4.9 [18], 5.1 [53] and 18.6 [17] alleles per locus. This allelic diversity can be effectively used for various applications ranging from diversity, evolutionary history and QTL mapping of complex traits in mulberry.
Figure 2

Gel image generated by the MultiNA for different Mulberry species, genotypes and other related species. All species and genotypes belong to family Moraceae. (a) Morus species, (b) Mulberry genotypes and (c) other related species.

Table 6

Genetic diversity and polymorphic information revealed by markers developed in mulberry and related species

Samples

Range

Genetic diversity

No. of alleles

Heterozygosity

PIC

All species and genotypes

Min

0.0799

2

0.000

0.0767

 

Max

0.9464

22

0.9091

0.9438

 

Mean

0.5969

5.47

0.1830

0.5592

Morus species only

Min

0.0000

1

0.000

0.0000

 

Max

0.9339

17

1.0000

0.9299

 

Mean

0.5860

4.97

0.1881

0.5431

Other related species

Min

0.0000

2

0.0000

0.0000

 

Max

0.8333

6

1.0000

0.8102

 

Mean

0.4090

2.57

0.0532

0.3457

While most of the markers developed in the study amplified the genomic DNA of all mulberry species and genotypes, a few also included private or rare alleles. For instance, Mul3SSR153 only could amplify a few particular mulberry species (M. lavigata, M. assambola) and a mulberry genotype (Dudia white). Such private/rare alleles have great utility in establishing the genetic authenticity of a particular species and/or genotype in germplasm characterization as well as in genetic screening experiments [54].

Most of the genic and genomic SSR markers developed in this study were highly informative with an average PIC value of 0.543 which ranged from 0.000 to 0.929 among mulberry species and genotypes (Table 6). Percentage of variation explained by the principal component analysis also revealed that 41% of the markers were effective in discriminating the variation among the mulberry species and genotypes confirming their efficiency in detecting genetic variations even among closely related varieties.

Two mulberry genotypes viz., Dudia white and UP105 were identified as contrasting lines differing in root traits and WUE in earlier studies [50]. These lines were crossed and a F1 segregating population was developed. Of the 188 markers examined, 94 genomic and 22 genic markers were found to be polymorphic between these two parents. These polymorphic markers would be a very useful genomic resource for constructing a genetic linkage map for mulberry. This work is in progress and when done would lead to the determination of the linkage between markers and their position on mulberry linkage groups.

In the present investigation, we report a large number of genic and genomic SSR markers that can be exploited to examine the diversity among mulberry genotypes and species. However, the relevance of the marker system would increase if they are transferable to other species.

Transferability of the SSR markers to other related species

The transferability of the mulberry SSR markers was examined using three species belonging to the family Moraceae viz.,Ficus (F.bengalensis), Fig (F. carica), and Jackfruit (A. heterophyllus) (Table 4). Of all the markers evaluated 78% (107) genomic and 82% genic (42) markers showed locus specific amplification in at least one of the three species studied (Table 5). Around 30% of the markers were transferable to all the three species. Of the 107 genomic and 42 genic markers, 70% and 76% were transferable to jackfruit. The transferability of these markers was relatively low in Fig and Ficus, which ranged between 41 to 46% (Table 5). It can be perceived that the genic regions of related genomes would be more conserved than the non-coding regions and hence would have higher transferability [55]. These markers would be highly useful for genome mapping and comparative genomics in mulberry and other closely related species belonging to Moraceae.

Several reports confirm the molecular relatedness of mulberry with a few other plant species belonging to the family Moraceae[56, 57]. Thus, the effective transferability of both genic and genomic SSR markers to these species can be expected. In this context, the present study is significant as a large proportion of the mulberry markers were found to be effectively transferable to these closely related species of family Moraceae.

Diversity analysis

Genetic diversity among the mulberry and three closely related species from the family Moraceae was analyzed using the 188 locus specific markers. We used two clustering algorithms viz., Unweighted Neighbor Joining (NJ) and factorial analysis (FA) to group the species and genotypes. The results of genetic relationships among the species and mulberry genotypes based on NJ and FA is presented in Figures 3 and 4. Both the algorithms were congruent and grouped the species and genotypes into four clusters. A. heterophyllus, F. bengalensis and F. carica segregated into a distinct cluster (I) while other mulberry species and genotypes clustered separately (II, III and IV). It was interesting to note that Dudia white clustered along with M. lavigata and M. assambola, while all other mulberry species and genotypes grouped into clusters III and IV. Though the dendrogram in Figure 3 indicates clusters III and IV as different, based on the boot strap values, these clusters could be considered as not significantly distinct. Therefore it is apparent that all the mulberry genotypes and species share common alleles except the genotype Dudia white and mulberry species M. lavigata and M. assambola.The diversity structure represented by the factorial analysis also indicated a similar grouping pattern for the mulberry species and genotypes (Figure 4). Though Dudia white is often considered as a genotype of M. alba, there is no firm molecular evidence for its origin.
Figure 3

Genetic diversity analysis of mulberry species, genotypes and three related species using both genomic and genic microsatellite markers. Ficus (Ficus bengalensis), Fig (Ficus carica) and Jackfruit (Artocarpus heterophyllus) were the closely related species examined for the transferability of microsatellite markers developed. All species and genotypes belong to family Moraceae.

Figure 4

Factorial analysis for grouping of mulberry species, genotypes and three related species using genomic and genic SSR markers. Ficus (Ficus bengalensis), Fig (Ficus carica) and Jackfruit (Artocarpus heterophyllus) were the closely related species examined for the transferability of microsatellite markers developed. All species and genotypes belong to family Moraceae.

The genetic relatedness of the 14 species and genotypes is explained in the Table 7. Based on the dissimilarity matrix Fig and UP105 showed maximum dissimilarity (93.8%) and Fig and Ficus showed the least (38%). Among the mulberry species and genotypes, the minimum genetic dissimilarity (44.4%) was observed between M. alba and M. exotica and highest dissimilarity of 74.7% was found between Dudia white and UP105. These two genotypes significantly differed in physiological traits such as root length and water use efficiency [50].
Table 7

Dissimilarity matrix of mulberry and other related species tested for transferability of genic and genomic SSR markers

Accessions

Mulberry species

Mulberry genotypes

Related species

M. Lavigata

M. indica

M. assambola

M. macroura

M. multicaulis

M. exotica

M. alba

Himachal Local

UP105

Dudia white

MS3

Jackfruit

Ficus

Fig

M. lavigata

1

             

M.indica

0.602

1

            

M.assambola

0.535

0.629

1

           

M.macroura

0.615

0.544

0.641

1

          

M.multicaulis

0.620

0.578

0.647

0.590

1

         

M.exotica

0.608

0.527

0.634

0.550

0.584

1

        

M.alba

0.576

0.495

0.602

0.518

0.552

0.444

1

       

Himachal local

0.662

0.620

0.689

0.632

0.597

0.626

0.594

1

      

UP105

0.682

0.640

0.708

0.652

0.616

0.645

0.613

0.582

1

     

Dudia white

0.625

0.668

0.651

0.680

0.686

0.673

0.641

0.728

0.747

1

    

MS3

0.630

0.587

0.656

0.600

0.564

0.593

0.561

0.581

0.600

0.695

1

   

Jackfruit

0.734

0.753

0.760

0.765

0.771

0.758

0.727

0.813

0.832

0.799

0.780

1

  

Ficus

0.833

0.852

0.859

0.864

0.870

0.857

0.825

0.912

0.931

0.898

0.879

0.704

1

 

Fig

0.840

0.859

0.867

0.871

0.877

0.865

0.833

0.919

0.938

0.905

0.886

0.711

0.380

1

Overall, the diversity analysis clearly indicates that the markers reported in this study are very well conserved across the taxa and can be effectively utilized to study the genetic relationship among varieties, genotypes and species of Moraceae.

Conclusion

Considering the commercial importance of mulberry and the complexity of trait based breeding, a focused molecular breeding strategy needs to be evolved for the genetic enhancement of this crop. Lack of sufficient genomic resources such as SSR markers has been one of the major constraints. We report a total of 188 robust locus specific SSR markers generated by analyzing 3485 genic and genomic sequences of mulberry genome. The markers developed were highly efficient in characterizing seven different mulberry species and four contrasting genotypes of Morus alba L. These markers also exhibited extensive transferability to other related species belonging to the family Moraceae viz., Ficus (Ficus bengalensis), Fig (Ficus carica) and Jackfruit (Artocarpus heterophyllus). The markers displayed high levels of polymorphic information content (PIC) and heterozygosity, enhancing the opportunities of using these markers in diversity analysis as well as for tagging QTLs governing complex agronomic and physiological traits. All the markers developed have been deposited in NCBI/EMBL database and are publicly available.

Methods

Plant materials and DNA extraction

Two strategies were adopted for the generation of genomic resources of microsatellite markers for mulberry. Microsatellite motifs in the genomic regions were identified by adopting the pre-cloning enrichment strategy using the genomic DNA isolated from a mulberry genotype Dudia white. Similarly, a stress expressed sequence tag (EST) was analyzed to identify microsatellite motifs in genic regions of mulberry genome. Details of the methodology adopted are described below.

Pre-cloning enrichment strategy for the construction of genomic library and mining of microsatellite motifs

The SSR enriched genomic library was constructed by a modified method of Saghaimaroof et al. [58]. Four micrograms of high quality genomic DNA was extracted from a genotype, Dudia white. This genotype was identified based on the extensive phenotyping carried out with a diverse set of mulberry germplasm [50]. The genomic DNA was digested by blunt-end generating restriction endonuclease, RsaI (MBI Fermentas, USA). This restriction reaction generated a large number of approximately 500–1000 base pair fragments. The ligation of Super SNX linkers, consisting of a Super SNX 24-mer (5’-GTTT AAGGCCTAGCTAGCAGAATC-3’) and a phosphorylated 28-mer (5’- pGATTCTGCTAGCTAGGCCTTAAACAAAA-3’) to the blunt termini of restriction fragments was performed for 2 hours at 37°C. To ensure linker ligation, 10 μl of digested and ligated product was pre-amplified using 1.5 μl of Super SNX24 Forward primer (10 μM), 150 μM of dNTPs, 2 mM MgCl2, 1 unit of Taq DNA polymerase and 25 μg/ ml of BSA in a volume of 25 μl. Self-ligation of the linkers was avoided by adding 1 unit of the restriction enzyme, XmnI. PCR amplification was carried out with a program consisting ofan initial DNA denaturation step of 95°C for 2 min followed by 20 cycles of: DNA denaturation step at 95°C for 20 s, primer annealing cycle with the appropriate temperature for specific primer pairs for 20s and a DNA extension cycle of 72°C for 2 mins. A final elongation step of 72°C for 10 min was performed to ensure complete amplification of the fragments. All PCR amplifications were carried out using an Eppendorf Master Cycler (Eppendorf, Hamburg). An aliquot of the amplicons was resolved on a 1.2% agarose gel to check the success of linker ligation.

The restriction digested and linker-ligated DNA fragments were captured by hybridizing with biotinylated microsatellite oligonucleotides (Sigma Aldrich): [CA]17, [AG]16, [AGC]8, [AGG]8, [ACGC]5, [ACCT]8, [AAC]14, [ATC]14 and [AAG]14. The enrichment of microsatellites was carried out in 50 μL reaction volume containing 25 μL 2× hybridization solution (12× Sodium saline citrate, 0.2% SDS), 10 μL equimolar biotinylated microsatellite oligos and 2 μg of linker ligated DNA. The hybridization of the microsatellite harboring genomic DNA fragments with the biotinylated microsatellite probes was facilitated by a touchdown temperature PCR consisting of 99 cycles of 95°C/5 min, 70°C/5 sec, 68.8°C/5 sec, 68.6°C/5 sec with step down of 0.2°C for every 5 sec until it reaches 50°C. The temperature in the tubes was then maintained at 50°C for 10 min. Subsequently, a program consisting of 20 cycles of 49.5°C/5 sec with step down of 0.5°C every 5 sec until it reaches 40°C/5 sec and finally held at 15°C.

The touchdown PCR conditions facilitate the microsatellite probes to hybridize with complimentary DNA repeat fragments (i.e., expectantly long prefect repeats) when the reaction mixture is at or near the microsatellite probes melting temperature. Hybridized fragments were selectively isolated using Streptavidin coated paramagnetic beads (Roche, Mannheim, Germany). Enriched DNA fragments were amplified with super SNX24 primers and purified using PCR purification column (Sigma, USA). The purified enriched products were ligated to pTZ57R/T vector (MBI Fermentas, USA) using T4-DNA ligase overnight at 16°C. The ligated genomic inserts were cloned in competent E. coli DH5α host cells and grown over night at 37°C. The transformed colonies were confirmed by performing PCR using M13 universal primers (3 μM), 100 μM dNTPs, 2 mM MgCl2, 1 U Taq DNA polymerase and 1X PCR buffer, at an annealing temperature of 58°C for 30 cycles. PCR products of the recombinant clones were purified using PCR-purification column (Sigma, USA) and sequenced using M13 forward and reverse primers on ABI 3700 sequencer.

Development of EST library to identify genic microsatellite markers

A stress transcriptome was developed by extracting the total mRNA from the leaves of water stressed and well watered mulberry plants. A widely adopted mulberry variety, K2 was used for this purpose. A modified guanidiumisothiocyanate protocol [59] was adopted to isolate total RNA from mature leaf tissue. Total messenger RNA (mRNA) was then isolated from 1 mg of total RNA using mRNA isolation kit (Promega). The mRNA was reverse transcribed to develop cDNA and the ESTs have been isolated [19]. These EST sequences were used in this investigation to develop genic SSR markers.

SSR marker development

Initially, the sequences were analyzed to identify unique and non-redundant libraries of genic and genomic regions for designing primers. The nucleotide sequences were analyzed using the Clustal-W, an on-line toolto determine the complemetarity between pairs of sequences. The non-redundant sequences were analyzed with “Mreps” software (http://bioinfo.lifl.fr/mreps/mreps.php) to identify sequences containing microsatellite motifs. The analysis revealed the presence of a single nucleotide base being the repeat motif (mono nucleotide repeat – MNR) to as high as regions with more than six bases (long nucleotide repeat – LNR). The MNR and LNR sequences were omitted from further analysis and primers were designed only the sequences with repeat motifs of two nucleotides (di-nucleotide repeats – DNR) and six nucleotides (hexa-nucleotide repeats – HNR). Primer3, also online software was used for designing appropriate primers [60]. The quality of primers was determined using the FAST PCR program and only those primers that would amplify a fragment in the range of 150 and 450 base pairs of template DNA were selected. Synthesis of these primers was outsourced to Bioserve India Pvt. Ltd., Hyderabad). Each of the primer pairs was standardized for their locus specific amplification using the genomic DNA of Dudia white as a template. Gradient-PCR was carried out in a total volume of 15 μL containing 2 ng of DNA template, 1× Taq buffer, 2 mM MgCl2, 0.2 mM dNTPs, 1 U Taq DNA polymerase (MBI Fermentas, USA) and 3 μM each of forward and reverse primers. Amplification was performed in a epGradient Master cycler (Eppendorf, Hamburg)with the following PCR conditions: DNA denaturation at 95°C for 5 min followed by 30 cycles of 95°C for 1 min, primer annealing temperatures ranging between 45-65°C for 45 s (depending on the Ta for each primer pair) and a DNA extension step of 72°C for 45 s and a final extension step at 72°C for 8 min. The details of the primer sequences, their annealing temperatures, expected amplicon size etc. are summarized in Table 2 and Table 3. The amplified products were resolved on 3% agarose gels. Only those primer pairs that produced unambiguous single band amplification alone were considered for the development of SSR markers in mulberry. This stringency ensured the development of robust SSR markers in mulberry which can be effectively used for diversity analysis as well as for constructing genetic linkage maps. Only such markers were further used for validation.

Validation of markers

Each of the markers was examined for their ability in amplifying the genomic DNA from other mulberry species and genotypes. Genomic DNA was extracted from seven distinct mulberry species and four contrasting genotypes of mulberry using a modified CTAB method [61]. These four genotypes were selected based on the extensive phenotyping of a set of 295 germplasm accessions for the variability in root traits and water use efficiency. Thus, the four genotypes represent contrast for these highly relevant drought adaptive traits. The list of the mulberry species and genotypes are given in Table 4. The template DNA from the different mulberry species and genotypes were amplified using each of the primers for genic and genomic microsatellite markers. The PCR conditions followed are same as that adopted for gradient PCR, explained above. All the amplified products were analyzed on microchip based electrophoresis system MultiNA (Shimadzu biotech, Japan) and the highest peak detected by the fragment analyzer was scored for the presence of the expected band for each primer pair. The polymorphism data was scored and used for the determination of polymorphic information content (PIC) for each marker as per Liu and Muse [62], Observed heterozygosity and allele diversity were computed using the Power Marker 3.25 software [62]. The most appropriate locus specific marker competent to divulge the variation among the species and genotypes was determined by principle component analysis (PCA).

Genetic diversity and cross species transferability

It is well known that there would be significant levels of sequence homology between closely related species and hence, there would be a possibility of a specific SSR marker detecting a similar locus in other related species. Establishment of the transferability of markers to other related species is therefore important while developing locus specific marker systems. The transferability of these markers was examined in three closely related species belonging to the family Moraceae, namely Ficus (F. bengalensis), Fig (F. carica) and Jackfruit (A. heterophyllus) (Table 4).

The percentage of transferability of the markers was calculated for each species by determining the presence of target loci to the total number of loci analyzed. The allelic diversity data obtained for all the microsatellite loci amplified were used to compute the genetic dissimilarity using DARwin v.5.0 program [63]. The dissimilarity matrix was further used to group the species according to their genetic relatedness based on Unweighted Neighbor Joining method and factorial analysis.

Notes

Declarations

Acknowledgement

This work was carried out with the financial support from Department of Biotechnology (DBT), Government of India to MSS which is sincerely acknowledged (File No: Grant/DBT/CSH/GIA/1395/2010-11. We also wish to thank the Departments of Sericulture and Horticulture, UAS, Bangalore for kindly providing the samples of mulberry and other related species, respectively. We acknowledge the technical inputs and suggestions by Dr. T.K. Narayanaswamy, Professor of Sericulture.

Authors’ Affiliations

(1)
Department of Crop Physiology, University of Agricultural Sciences
(2)
Department of Sericulture, University of Agricultural Sciences
(3)
Department of Plant Molecular Biology, University of Delhi

References

  1. Kshama G, Mahanta JC, Deole AL, Kantharaju BM: Raw silk production: 2007–08. Indian Silk. 2008, 47: 43-44.Google Scholar
  2. Khurana P, Checker VG: The advent of genomics in mulberry and perspectives for productivity enhancement. Plant Cell Rep. 2011, 30: 825-838. 10.1007/s00299-011-1059-1.PubMedView ArticleGoogle Scholar
  3. Zietjiewicz E, Rafalski A, Labuda D: Genome fingerprinting by simple sequence repeat (SSR) – anchored polymerase chain reaction amplification. Genomics. 1994, 20: 176-183. 10.1006/geno.1994.1151.View ArticleGoogle Scholar
  4. Prevost A, Wilkinson MJ: A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor Appl Genet. 1999, 98: 107-112. 10.1007/s001220051046.View ArticleGoogle Scholar
  5. Gepts P: The use of molecular and biochemical markers in crop evolution studies. Evol. Biol. 1993, 27: 51-94.View ArticleGoogle Scholar
  6. Mathithumilan B, Dandin SB: Genetic analysis of diploid and colchi-tetraploid mulberry (Morus indica and Morus alba) by molecular and morphological markers. Int J Plant Breed. 2008, 3: 58-64.Google Scholar
  7. Vijayan K, Chatterjee SN: ISSR profiling of Indian cultivars of mulberry (Morus spp.) and its relevance to breeding programs. Euphytica. 2003, 131: 53-63. 10.1023/A:1023098908110.View ArticleGoogle Scholar
  8. Vijayan K, Srivastava PP, Awasthi AK: Analysis of phylogenetic relationship among five mulberry (Morus) species using molecular markers. Genome. 2004, 47: 439-448. 10.1139/g03-147.PubMedView ArticleGoogle Scholar
  9. Awasthi AK, Nagaraja GM, Naik GV, Sriramana K, Thangavelu K, Nagaraju J: Genetic diversity and relationships in mulberry (Genus Morus) as revealed by RAPD and ISSR marker assays. BMC Genet. 2004, 5: 1-18.PubMedPubMed CentralView ArticleGoogle Scholar
  10. Beckmann JS, Soller M: Toward a unified approach to genetic mapping of eukaryotes based on sequence tagged microsatellite sites. Bio Tech. 1990, 8: 930-932. 10.1038/nbt1090-930.View ArticleGoogle Scholar
  11. Tautz D, Renz M: Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucl Acid Res. 1984, 25: 4127-38.View ArticleGoogle Scholar
  12. Bhat PR, Krishnakumar V, Hendre PS, Rajendrakumar P, Varshney RK, Aggarwal RK: Identification and characterization of expressed sequence tags-derived simple sequence repeats markers from robusta coffee variety ‘CxR’ (an interspecific hybrid of Coffea canephora x Coffeacongensis). Mol Ecol Notes. 2005, 5: 80-83. 10.1111/j.1471-8286.2004.00839.x.View ArticleGoogle Scholar
  13. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y, Zhang Q, Kono I, Yano M, Fjellstrom R, De Clerck G, Schneider D, Cartinhour S, Ware D, Stein L: Development and Mapping of 2240 New SSR Markers for Rice (Oryza sativa L.). DNA Res. 2002, 9: 199-207. 10.1093/dnares/9.6.199.PubMedView ArticleGoogle Scholar
  14. Abbott AG, Sosinski BM, Gannavarapu LD, Hager LE, Beck GJ, King CD, Ryder S, Rajapakse WV, Baird RE, Ballard : Characterization of microsatellite markers in peach (Prunuspersica (L.) Batsch). Theor Appl. Genet. 2000, 101: 421-428. 10.1007/s001220051499.View ArticleGoogle Scholar
  15. Mookerjee S, Guerin J, Collins G, Ford C, Sedgley M: Paternity analysis using microsatellite markers to identify pollen donors in an olive grove. Theor Appl Genet. 2005, 111: 1174-1182. 10.1007/s00122-005-0049-5.PubMedView ArticleGoogle Scholar
  16. Giraldo E, Viruel MA, Opez-Corrales ML, Hormaza JI: Characterization and cross-species transferability of microsatellites in the common fig (Ficus carica L.). J Hort Sci Biotechnol. 2005, 80: 217-224.Google Scholar
  17. Aggarwal RK, Udaykumar D, Hendre PS, Sarkar A, Singh LI: Isolation and characterization of six novel microsatellite markers for mulberry (Morus indica). Mol Ecol Notes. 2004, 4: 477-479. 10.1111/j.1471-8286.2004.00718.x.View ArticleGoogle Scholar
  18. Zhao W, Miao X, Jia S, Pan Y, Huang Y: Isolation and characterization of microsatellite loci from the mulberry, Morus L. Plant Science. 2005, 168: 519-525. 10.1016/j.plantsci.2004.09.020.View ArticleGoogle Scholar
  19. Khurana P, Khurana JP, Ravi V, Lal S: Repertoire of leaf expressed sequence tags (ESTs) and partial characterization of stress-related and membrane transporter genes from mulberry(Morus indica L.). Tree Genet Genomes. 2009, 5 (2): 359-374. 10.1007/s11295-008-0192-7.View ArticleGoogle Scholar
  20. Gulyani V, Khurana P: Identification and expression profiling of drought-regulated genes in mulberry (Morus sp.) by suppression subtractive hybridization of susceptible and tolerant cultivars. Tree Genet Genomes. 2011, 7: 725-738. 10.1007/s11295-011-0369-3.View ArticleGoogle Scholar
  21. Checker VG, Saeed B, Khurana P: Analysis of expressed sequence tags from mulberry (Morus indica) roots and implications for comparative transcriptomics and marker identification. Tree Genet Genomes. 2012, 8: 1437-1450. 10.1007/s11295-012-0531-6.View ArticleGoogle Scholar
  22. Li Y, Korol AB, Fahima T, Beiles A, Nevo E: Microsatellites within genes: structure, function, and evolution. Mol Biol Evol. 2004, 6: 991-1007.View ArticleGoogle Scholar
  23. Lagercrantz U, Ellegren H, Andersson L: The abundance of various polymorphic SSR motifs differs between plants and vertebrates. Nucl Acid Res. 1993, 21: 1111-1115. 10.1093/nar/21.5.1111.View ArticleGoogle Scholar
  24. Morgante M, Olivieri AM: PCR-amplified SSRs as markers in plant genetics. Plant J. 1993, 3: 175-182. 10.1111/j.1365-313X.1993.tb00020.x.PubMedView ArticleGoogle Scholar
  25. Wang Z, Weber JL, Zhong G, Tanksley SD: Survey of plant short tandem DNA repeats. Theor Appl Genet. 1994, 88: 1-6.PubMedGoogle Scholar
  26. Liu BH: Statistical Genomics: In Linkage Mapping and QTL Analysis. Boca Raton: CRC Press, FA: 1997.Google Scholar
  27. Edwards KJ, Barker JHA, Daly A, Jones C, Karp A: Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques. 1996, 20: 758-760.PubMedGoogle Scholar
  28. Zane L, Bargelloni L, Patarnello T: Strategies for microsatellite isolation: a review. Mol Ecol. 2002, 11: 1-16. 10.1046/j.0962-1083.2001.01418.x.PubMedView ArticleGoogle Scholar
  29. Ferguson ME, Burow MD, Schultz SR, Bramel PJ, Paterson AH, Kresovich S, Mitchell S: Microsatellite identification and characterization in peanut (A. hypogaea L.). Theor Appl Genet. 2004, 108: 1064-1070. 10.1007/s00122-003-1535-2.PubMedView ArticleGoogle Scholar
  30. He G, Meng R, Newman M, Gao G, Pittman RN, Prakash CS: Microsatellites as DNA markers in cultivated peanut (Arachis hypogaea L.). BMC Plant Biol. 2003, 3: 3-9. 10.1186/1471-2229-3-3.PubMedPubMed CentralView ArticleGoogle Scholar
  31. Jung S, Abbott A, Jesudurai C, Tomkins J, Main D: Frequency, type, distribution and annotation of simple sequence repeats in Rosaceae ESTs. Funct Integr Genomics. 2005, 5: 136-143. 10.1007/s10142-005-0139-0.PubMedView ArticleGoogle Scholar
  32. Aggarwal RK, Hendre PS, Varshney RK, Bhat PR, Krishna kumar V, Singh L: Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet. 2007, 114: 359-372. 10.1007/s00122-006-0440-x.PubMedView ArticleGoogle Scholar
  33. Feng SP, Li WG, Huang HS, Wang JY, Wu YT: Development, characterization and cross-species/genera transferability of ESTSSR markers for rubber tree (Hevea brasiliensis). Mol Breed. 2009, 23: 85-97. 10.1007/s11032-008-9216-0.View ArticleGoogle Scholar
  34. Nicot N, Chiquet V, Gandon B, Amilhat L, Legeai F, Leroy P, Bernard M, Sourdille P: Study of simple sequence repeat (SSR) markers from wheat expressed sequence tags (ESTs). Theor Appl Genet. 2004, 109: 800-805. 10.1007/s00122-004-1685-x.PubMedView ArticleGoogle Scholar
  35. Gao LF, Tang JF, Li HW, Jia JZ: Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol Breed. 2003, 12: 245-261. 10.1023/A:1026346121217.View ArticleGoogle Scholar
  36. Moretzsohn MC, Leoi L, Proite K, Guimaraes PM, Leal-Bertioli SCM, Gimanes MA, Martin WS, Valls JFM, Grattapaglia D, Bertioli D: A microsatellite based, gene-rich linkage map for the AA genome of Arachis (Fabaceae). Theor Appl Genet. 2005, 111: 1060-1071. 10.1007/s00122-005-0028-x.PubMedView ArticleGoogle Scholar
  37. Gimenes MA, Hosino AA, Barbosa AVG, Palmieri DA, Lopes CR: Characterization and transferability of microsatellite markers of cultivated peanut (Arachis hypogaea). BMC Plant Biol. 2007, 7: 9. 10.1186/1471-2229-7-9.PubMedPubMed CentralView ArticleGoogle Scholar
  38. Butcher PA, Decroocq S, Gray Y, Moran GF: Development, inheritance and cross-species amplification of microsatellite markers from Acacia mangium. Theor. Appl. Genet. 2000, 101: 1282-1290. 10.1007/s001220051608.View ArticleGoogle Scholar
  39. De Wiel CV, Arens P, Vosman B: Microsatellite retrieval in lettuce (Lactuca sativa L.). Genome. 1998, 42: 139-150.View ArticleGoogle Scholar
  40. Cuc LM, Mace ES, Crouch JH, Quang VD, Long TD, Varshney R: Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea). BMC Plant Biol. 2008, 8: 55. 10.1186/1471-2229-8-55.PubMedPubMed CentralView ArticleGoogle Scholar
  41. Weber JL: Informativeness of human (dC-dA)n (dG-dT)n polymorphism. Genomics. 1990, 7: 524-530. 10.1016/0888-7543(90)90195-Z.PubMedView ArticleGoogle Scholar
  42. Hopkins MS, Casa AM, Wang T, Mitchell SE, Dean RE, Kochertgandkresovich S: Discovery and characterization of polymorphic simple sequence repeats (SSRs) in peanut. Crop Sci. 1999, 39: 1243-1247. 10.2135/cropsci1999.0011183X003900040047x.View ArticleGoogle Scholar
  43. Scotti I, Vendramin GG, Matteotti LS, Scarponi C, Sari-Gorla M, Binelli G: Postglacial recolonization routes for Piceaabies K. in Italy as suggested by the analysis of sequence-characterized amplified region (SCAR) markers. Mol Ecol. 2000, 9: 699-708. 10.1046/j.1365-294x.2000.00911.x.PubMedView ArticleGoogle Scholar
  44. Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ: Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to Erianthus and Sorghum. Plant Sci. 2001, 160: 1115-1123. 10.1016/S0168-9452(01)00365-X.PubMedView ArticleGoogle Scholar
  45. Metzgar D, Bytof J, Wills C: Selection against frame shift mutations limits microsatellite expansion in coding DNA. Genome Research. 2000, 10: 72-80.PubMedPubMed CentralGoogle Scholar
  46. Morgante M, Hanafey M, Powell W: Microsatellites are preferentially associated with non-repetitive DNA in plant genomes. Nat. Genet. 2002, 30: 194-200. 10.1038/ng822.PubMedView ArticleGoogle Scholar
  47. Wang Y, Kang M, Huang M: Microsatellite Loci Transferability in Chestnut. J Amer Soc Hort Sci. 2008, 133: 692-700.Google Scholar
  48. Marcotte EM, Pellegrini M, Yeates TO, Eisenberg D: A census of protein repeats. J Mol Biol. 1999, 293: 151-160. 10.1006/jmbi.1999.3136.PubMedView ArticleGoogle Scholar
  49. Wren JD, Forgacs E, Fondon JW, Pertsemlidis A, Cheng SY: Repeat polymorphisms within gene regions: Phenotypic and evolutionary implications. Am J Human Genet. 2000, 67: 345-356. 10.1086/303013.View ArticleGoogle Scholar
  50. Vinoda KS: Identification of QTLs conditioning water use efficiency and associated traits in mulberry though marker assisted selection. PhD thesis:2010.Google Scholar
  51. Varshney RK, Graner A, Sorrells ME: Genic microsatellite markers in plants: Features and applications. Tren biotech. 2005, 23: 48-55. 10.1016/j.tibtech.2004.11.005.View ArticleGoogle Scholar
  52. Grattapaglia D, Plomion C, Krist M, Sedroff R: Genomics of growth traits in forest tress. Curr Opin Plant Biol. 2009, 12: 1-9. 10.1016/j.pbi.2008.12.005.View ArticleGoogle Scholar
  53. Zhao WG, Zhou ZH, Miao XX, Zhang Y, Wang SB, Huang JH, Xiang H, Pan YL, Huang YP: A comparison of genetic variation among wild and cultivated Morus species (Moraceae: Morus) as revealed by ISSR and SSR markers. Biodiv Conserv. 2007, 6: 275-290.Google Scholar
  54. Kalinowski ST: Counting alleles with rarefaction: private alleles and hierarchical sampling designs. Conser Genet. 2004, 5: 539-543.View ArticleGoogle Scholar
  55. Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS: Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Genet Genomics. 2003, 270: 315-323. 10.1007/s00438-003-0921-4.PubMedView ArticleGoogle Scholar
  56. Datwyler SL, Weiblen GD: On the origin of the Fig: Phylogenetic relationships of Moraceae from NDHF sequences. Am J Bot. 2004, 5: 767-777.View ArticleGoogle Scholar
  57. Leitch IJ, Chase MW, Bennett MD: Phylogenetic analysis of DNA C-values provides evidence for a small ancestral genome size in flowering plants. Annal Bot. 1998, 82: 85-94.View ArticleGoogle Scholar
  58. Saghaimaroof MA, Solima KM, Jorgenson RA, Allard RW: Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proceed Nat Acad Sci. 1984, 81: 8014-8018. 10.1073/pnas.81.24.8014. USAView ArticleGoogle Scholar
  59. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal Biochem. 1987, 162: 156-9.PubMedView ArticleGoogle Scholar
  60. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Met Mol Biol. 2000, 132: 365-386.Google Scholar
  61. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidmann JG, Smith JA, Struhl E: (Eds): Current protocols in molecular biology volume 3. New York: John Wiley and Sons:2003:Google Scholar
  62. Liu K, Muse SV: Power Marker: an integrated analysis environment for genetic marker analysis. Bioinformatics. 2005, 21: 2128-2129. 10.1093/bioinformatics/bti282.PubMedView ArticleGoogle Scholar
  63. Perrier X, Flori A, Bonnot F: Data analysis methods. In Genetic diversity of cultivated tropical plants. Edited by: Hamon P, Seguin M, Perrier X, Glaszmann JC. 2003, Enfield: Science Publishers, Montpellier, 43-76.Google Scholar

Copyright

© Mathithumilan et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.