Skip to main content

Table 3 Details of the genic (EST) SSR markers developed for mulberry

From: Development and characterization of microsatellite markers for Morus spp. and assessment of their transferability to other closely related species

Sl no Primer name Primer sequence GenBank-ID Amplicon size Repeat motif Ta (0°C) Repeat type
1 MESTSSR10F CATTGCACATTGCAGGTAGC GT629469.1 237 GTT 52.8 Perfect
  MESTSSR10R CGGCCATCCAAAATGTTGTTC      
2 MESTSSR13F TCTATCTCAACCGGAAGTCC GT628644.1 230 (CAAAAG)G(AAAATA) 54.8 interrupted
  MESTSSR13R CCAATTTGCTCGTCTTATGC      
3 MESTSSR14F CGGCCACAGGTACTTTC GT628768.1 202 TTGATT 50.4 Perfect
  MESTSSR14R GGCAGCGATTTAGGATTGG      
4 MESTSSR20F CGCAAGTGTCTCAACTG GT629110.1 200 TGA 49.1 Perfect
  MESTSSR20R GGAACGGATGGAGTAAG      
5 MESTSSR23F GGCCCAAACTCCATAGC ES448350.1 202 TAC 50.4 Perfect
  MESTSSR23R CCGCCAATTCTAGACCAATG      
6 MESTSSR26F CGTGATTACCTTCGGATTGG ES448391.1 219 AGCTGG 57.9 Perfect
  MESTSSR26R CCAACCCAGTAGACCCAGTG      
7 MESTSSR27F CCAACATTATCCGGAACACC ES448394.1 266 CGG 54.8 Perfect
  MESTSSR27R GGTAAAGCCATCCGTTGC      
8 MESTSSR28F GCCCAGTTTCCCACAGAA ES448403.1 217 ATA 47.9 Perfect
  MESTSSR28R GGATGGTTTGTGCGTGC      
9 MESTSSR31F CACCAATTAAAAGCGCAGTG ES448813.1 204 GA 57.9 Perfect
  MESTSSR31R CTTTGTGGTTGGCTCGTG      
10 MESTSSR35F CGTTTTCCGCTTCAGAGAG ES448478.1 206 AG 54.8 Perfect
  MESTSSR35R GCCGATATCCTCCTTTCCTC      
11 MESTSSR37F CAAAAGCGGTTTGGAATAGC ES448476.1 245 (CTTTC) CTCC(T) 54.8 interrupted
  MESTSSR37R CCTCAACACAAAACCCACC      
12 MESTSSR40F GAATCCTACAAGGGAGC ES449069.1 215 AAAAT 52.8 Perfect
  MESTSSR40R CATACAAGGATGCCCACC      
13 MESTSSR41F GGTCGACAAGAGGTAATC ES449022.1 121 AAAAG 56.7 Perfect
  MESTSSR41R GAAGGCACCGAAGAGAAC      
14 MESTSSR42F CAAGAGGTAATCCGTTC ES448502.1 254 AG 54.8 Perfect
  MESTSSR42R CGTTGTTAGCAGGAGC      
15 MESTSSR46F GCCCATGTTTGCGGAG ES449184.1 200 AG 56.7 Perfect
  MESTSSR46R GGATTTTTCTGTCTGGGTG      
16 MESTSSR47F GACTGCGGGAGAACAG ES448510.1 220 CTC 54.8 Perfect
  MESTSSR47R GTTCACCGAGGCTGAGAG      
17 MESTSSR48F GTTGTGGTGGTTGTTGC ES448516.1 201 TC 56.7 Perfect
  MESTSSR48R CCTTCACTTTCTCGCC      
18 MESTSSR49F CTTCGACGCCTTCTGCG ES448598.1 184 GAAGA 56.7 Perfect
  MESTSSR49R GAGCGTCTCGAAGCAGTTG      
19 MESTSSR50F GCCGGCATGTACGGATA ES448967.1 235 CCTAAC 54.8 Perfect
  MESTSSR50R GTAAAAGTTTCGCCCCAGG      
20 MESTSSR51F CCTAGGGTTTCCTTCGCTTC ES448621.1 223 GCG 54.8 Perfect
  MESTSSR51R CGCTTAGGCTCCTTCCTC      
21 MESTSSR52F CTTCGTTACGCTCGCTATG ES448640.1 261 TATTTT 56.7 Perfect
  MESTSSR52R CCTTCTCTCAAGAATACTGG      
22 MESTSSR53F GGCCAACATGTACGGATAG ES449078.1 203 CCTAAC 56.7 Perfect
  MESTSSR53R CGCCAGGTACAACAAGAAG      
23 MESTSSR56F CATTGCGTTCCTTGAG ES448442.1 220 ATCATG 58.8 Perfect
  MESTSSR56R GGAGCCAAGACTCCTAAG      
24 MESTSSR59F GAGCTCCGACGACCAC ES448462.1 236 TCATGA 54.8 Perfect
  MESTSSR59R GCGTCTCGACGTGAGAAATAAC      
25 MESTSSR61F CCATAGCCTCAACGTTTC ES448534.1 239 AAAAAC 54.8 Perfect
  MESTSSR61R CGCTCACGTCCGTATC      
26 MESTSSR66F GGAAAATTCATCCCCCAAGC ES448761.1 258 TTTTTG 53.8 Perfect
  MESTSSR66R CGATGAGAAGCTCAAGGAG      
27 MESTSSR67F GTGCTCGTAGCTTTGATGG ES448763.1 215 ATCGCC 54.8 Perfect
  MESTSSR67R GCGAAGGAGAAGGAGGAGAG      
28 MESTSSR73F CTCAAGCTATGCATCCAACGC ES448909.1 237 CT 52.8 Perfect
  MESTSSR73R CCACTTCGAGAGCTTCG      
29 MESTSSR74F CCATGGCTGAGCACGAG ES448909.1 238 GAA, GAG 52.8 compound
  MESTSSR74R GAGCTCCAGTGTTCCTC      
30 MESTSSR76F GATCCAGAACTCCCAAACC ES448912.1 209 CTCCGT 50.4 Perfect
  MESTSSR76R GGTAATCCGAGTTCGAGACG      
31 MESTSSR77F CCATAGCCTCAACGTTTC ES448915.1 238 AAAAAC 52.8 Perfect
  MESTSSR77R CGCTCACGTCCGTATC      
32 MESTSSR78F GCACTCTCAAACAAATCCTC ES448921.1 242 AAGTGG 52.8 Perfect
  MESTSSR78R CGTTTGGAAACGGCTACTTC      
33 MESTSSR79F CCCATAGCCTCAACGTTTC ES448926.1 221 AAAAAC 45.9 Perfect
  MESTSSR79R CGACAACAACCGTCAAGTC      
34 MESTSSR85F GTCATCTATGTCGGGTGGTC ES448670.1 310 ATACAT 55.4 Perfect
  MESTSSR85R CATGGAGCGTTTGTTGTGTG      
35 MESTSSR99F GGCCAACATGTACGGATAG ES448967.1 203 CCTAAC 50.4 Perfect
  MESTSSR99R CGCCAGGTACAACAAGAAG      
36 MESTSSR108F GGCTCTGAATGTCCGAGAAG ES448289.1 246 GAGTTG 50.4 Perfect
  MESTSSR108R GGGTGGTAGATTTGGCAC      
37 MESTSSR109F CTCACGTCCGTATCATCG ES448314.1 244 TTTGTT 50.4 Perfect
  MESTSSR109R CCATTCCCATAGCCTCAAC      
38 MESTSSR111F CATCTATGTCGGGTGGTCG ES449122.1 299 AAAT 45.9 Perfect
  MESTSSR111R CTATGCACAACAGGCTGC      
39 MESTSSR113F GCCTCCCATTATGCACTATG ES449132.1 206 AAAACA 52.8 Perfect
  MESTSSR113R CGGATCTTCCAGGCTC      
40 MESTSSR115F CAGGAATCAGAGCCAGAGC ES448647.1 398 AAAAAC 53.8 Perfect
  MESTSSR115R CTGGACCATGTGGAAGC      
41 MESTSSR117F CATTATCCGGAACACCAGACG ES448396.1 247 CGG 53.8 Perfect
  MESTSSR117R GCTAAGAACCTCGCTCG      
42 MESTSSR121F CACGTCCGTATCATCGG ES449197.1 244 TTTGTT 52.8 Perfect
  MESTSSR121R CCATTCCCATAGCCTCAAC      
43 MESTSSR129F GATTACTCCAACCAACTCC ES449040.1 223 AAAACC 52.8 Perfect
  MESTSSR129R CAAGGGGGCTAGGAAG      
44 MESTSSR123F CATCTATGTCGGGTGGTCG ES448449.1 240 CT 52.8 Perfect
  MESTSSR123R GTGTTTGCTGGACTTTGC      
45 MESTSSR126F CACCGATGAGCCCTGGTC ES448693.1 200 TTC 52.8 Perfect
  MESTSSR126R GCACAATCCATCCCAAGTG      
46 MESTSSR127F CCAACATTATCCGGAACACC ES448594.1 285 CGG 52.8 Perfect
  MESTSSR127R CCTGGACGGAAGAAGTGG      
47 MESTSSR131F CCTCATTGCGTTCCTTGAG ES448442.1 225 ATA, ATCATG 54.1 compound
  MESTSSR131R CTGATTTGGGAGCCAAGAC      
48 MESTSSR132F CTATGTCGGGTGGTCG GT735086.1 473 TTTTCC 54.1 Perfect
  MESTSSR132R CATACCGTCGGAGATGC      
49 MESTSSR136F CCATTCCCATAGCCTC ES449178.1 244 AAAAAC 50.5 Perfect
  MESTSSR136R CGTCCGTATCATCGG      
50 MESTSSR134F GGTTGTTGTCGAATCCG ES448600.1 208 TTTGTT 55.4 Perfect
  MESTSSR134R GTACAAACCGAACGGGAAC      
51 MESTSSR135F CCTCATTGCGTTCCTTG ES448442.1 219 ATCATG 54.1 Perfect
  MESTSSR135R CCGGTGAGGTGATTGG