Skip to main content

Table 2 Details of the genomic SSR markers developed for mulberry

From: Development and characterization of microsatellite markers for Morus spp. and assessment of their transferability to other closely related species

Sl no Primer name Primer sequence GenBank-ID Amplicon size Repeat motif Ta (°C) Repeat type
1 MulSSRIF GATCTGAAGTCACCCAGCC GF101960 236 TC 56.8 Perfect
  MulSSRIR GCAGAATCTTTTCAGCTTCCA      
2 MulSSR2F GGTGCCTGAAGATATGTGG BV722881 154 AC 56.8 Perfect
  MulSSR2R CTCTGAGGGAAGCAGAAG      
3 MulSSR23F CGGAAACAGCCCAAAGAAGG GF101977 223 AAACCT 56.8 Perfect
  MulSSR23R AGGAGGGGTTTAGGGG      
4 MulSSR26F CCACTGGTGCCTGAAG BV722891 282 AC 56.8 Perfect
  MulSSR26R CATCTCATACTGGGGC      
5 MulSSR-82 F CAATCACTAACGGGGGAAG BV722895 240 CT 56.8 Perfect
  MulSSR-82R GCTCTTTTTGGTGCTCC      
6 MULSSR59F GGTTTCATTTTCCCTCTCGA BV722893 243 TTC 56.8 Perfect
  MULSSR59R GGCCGATGCGAACAGA      
7 MULSSR85F CCGGAGAAATTCCAAAGG BV722896 304 TC 56.8 Perfect
  MULSSR85R CATCCAGGCATCTGATTG      
8 MULSSR69F CAATATTACCACCCTCAC GF101963 294 TC 56.8 Perfect
  MULSSR69R GAAATGGTTTGCATCC      
9 M2SSR1F CTCTCGAGAAAGCCATCA GF107867 217 CA 50 Perfect
  M2SSR1R GGTTGTCAAGTAGGACCG      
10 M2SSR5F GCTCAGATTCGGTCATGG GF109684 186 TC 50 Perfect
  M2SSR5R CTGCTTCATGGTATCAGAGCAAGG      
11 M2SSR12F GCGACCATTCAACAGAACCA GF107890 270 AG 50 Perfect
  M2SSR12R GTGTTGTGGTTACTGGTTCC      
12 M2SSR13F GTGTGTTGAGTGTAGCGGC GF107891 154 GT 58 Perfect
  M2SSR13R CGACGAAGATAACGACACGAC      
13 M2SSR19aF GAAGAGCTCGCTACAAGG GF107894 178 TTTTC 51.5 Perfect
  M2SSR19aR GAAAGGCATGCTGCTCATG      
14 M2SSR20F CTAGAGAATCTTGGGCGATCC GF107896 230 TC 55 Perfect
  M2SSR20R ACCGAGCGCTAGTTGTCAG      
15 M2SSR21F GTTGCTGTGTGCTTGTGG GF107897 247 TG 45 Perfect
  M2SSR21R ACACAACACGTCAACCCAGA      
16 M2SSR53F GTTGCTGAGCGTGGTGATAG GF109658 172 AG 50 Perfect
  M2SSR53R ACGACACGCACACACGTC      
17 M2SSR65F GGCTGATAATCGCAATGC GF107874 173 AGG 51.5 Perfect
  M2SSR65R GCGTGCCCACGTAGGAAG      
18 M2SSR67F CGAGAAATTCCGACTCCATGGTC GF107901 158 CTC 55 Perfect
  M2SSR67R CCGGTGGTAGTGTTGCAAGAG      
19 M2SSR68F AATTCCGACTCCATGGTCAG GF107902 211 TCT 51.5 Perfect
  M2SSR68F TTCCGGTGGTAGTGTTGC      
20 M2SSR93F ATAGCCGATTTTGCAGGC GF107877 243 CTCC 50 Perfect
  M2SSR93R GAAATTCCGACTCCATGGTC      
21 M2SSR94bF ATTAGCCGTGCATCTCTGG GF107909 295 ACTA 55 Perfect
  M2SSR94bR CGATCACTTTCATGATCCGGG      
22 M2SSR102F GAGCAAGGTTTCTGAACCC GF107910 203 AAG 51.5 Perfect
  M2SSR102R CTCAGCAGTCGTCTGAGG      
23 M2SSR121F CGATCTGAAAGATGTCGTGC GF107913 210 CAC 45 Perfect
  M2SSR121R GCAACCGTCGTTCTCAGC      
24 Mul3SSR1F CGGAAAGGGTCATGTTG KF030980 150 AAAT 53 Perfect
  Mul3SSR1R CTGTCGTTATTGAGAGAGCAGG      
25 Mul3SSR2F GCTAGCAGATCCCACC KF030981 261 CT, GAGACC 53 Perfect
  Mul3SSR2R CAGCTCCTCTTCCACAAGC      
26 Mul3SSR4F GGAGCAGTCAATCTCTTG KF030982 314 (ATATAC)CAC(TA) 50 interrupted
  Mul3SSR4R CTGGGGTTCAAACTAAGCTC      
27 Mul3SSR6F GAGAGGTCGCCCCTTAG KF030983 335 GT 51.5 Perfect
  Mul3SSR6R GCCTCACAGGAGAACACC      
28 Mul3SSR7F CCATGGCTCTTTTGGTC KF030984 198 CTG 48.5 Perfect
  Mul3SSR7R GCAGAATCCAGCTTTTTGG      
29 Mul3SSR9F GACCAGCCATGAGCCTAC KF030985 378 GT, GA 51.5 Compound
  Mul3SSR9R GGTTCACAACCACAATCTCC      
30 Mul3SSR14F GGCGGTTTAGGAATATAGC KF030986 227 AG 47.5 Perfect
  Mul3SSR14R CCAAAACGAGAAGAACG      
31 Mul3SSR16F CTAGTAGCAGATCACCAC KF030987 207 A, AAAAG 49.5 Compound
  Mul3SSR16R CGGTCTCTCCCTAATCC      
32 Mul3SSR17 F GTCTTGCACTAGGAGAGG KF030988 345 GT 50.5 Perfect
  Mul3SSR17R CTCACAGGAGAACACCACC      
33 Mul3SSR19F CCAAGTCCTCCTCCAG KF030989 172 GAA 50 Perfect
  Mul3SSR19R GTTTTGTGACTTGCCG      
34 Mul3SSR20F CTAGCAGATCGTGGCATTG KF030990 252 (CT)TTCTCTAT(CT) 51 interrupted
  Mul3SSR20R CTCCGCCCAAAATATCACAC      
35 Mul3SSR21F CATCGCAAATAGGTGTGG KF030991 239 TC 52.5 Perfect
  Mul3SSR21R GGCAGTGAGAGCAAGGAG      
36 Mul3SSR23F GCTAGCAGATCCCAAG KF030992 224 TGCCAC, TCT 53.5 Compound
  Mul3SSR23R CGAAACCCGCATTCATTC      
37 Mul3SSR24F GCTCTTGTTGACACTGGC KF030993 225 TC 51 Perfect
  Mul3SSR24R CCGATTGTTTAAGGCC      
38 Mul3SSR25F GAGCCTTGTTCACCAC KF030994 155 AAG 50 Perfect
  Mul3SSR25R GGTCAACTTTCATGCC      
39 Mul3SSR26F GGTATGAGAGCTTCGCAC KF030995 202 (TC)G(TC) 52 interrupted
  Mul3SSR26R GTCTCGGGAACAACAGC      
40 Mul3SSR28F GGATCTTGCCATCTAGTGTG KF030996 112 TA,TG 53.5 Compound
  Mul3SSR28R GCAGAATCATAGAGGACC      
41 Mul3SSR31F GATCCACTTCCACTCCCAG KF030997 382 GTC, TTC 52 Compound
  Mul3SSR31R GGACGCATGAGGTTTTAGG      
42 Mul3SSR33F CTCCCGGATAAAAGACAACC KF030998 390 GAA 48.5 Perfect
  Mul3SSR33R CCTTGCTCATCATCATCG      
43 Mul3SSR34F CATTTTCCTCCTGACC KF030999 221 GA 53 Perfect
  Mul3SSR34R CAGTCCACGTCAGTTTC      
44 Mul3SSR36F GCAGAATCCCGGAGAAGAG KF031000 329 GAA 53 Perfect
  Mul3SSR36R GCAGAATCCCCTGTTTGG      
45 Mul3SSR41F CATCGCTCGTTTTCGCATC KF031001 251 CTT 49 Perfect
  Mul3SSR41R CACTAGCCCCTGCACC      
46 Mul3SSR43F CTCTGGAGTACAAGAACCG KF031002 345 GAA 49.5 Perfect
  Mul3SSR43R GGCACGATCCCAATCAAG      
47 Mul3SSR44F CGCGTATTTCGGATTTCC KF031003 238 CT, CA 52 Compound
  Mul3SSR44R GCTAGCAGAATCCCATC      
48 Mul3SSR49F CAACATCAACACCGATCACC KF031004 140 TCA 52 Perfect
  Mul3SSR49R GCAGAATCCCACCAACATC      
49 Mul3SSR50F CTAGCAGATCCACCAAACC KF031005 161 CTT 53 Perfect
  Mul3SSR50R GTTGTTGTACTCTCGCACG      
50 Mul3SSR52F CAGATCCCATACACAAAGCC KF031006 391 TTTTTC 51.5 interrupted
  Mul3SSR52R GTGAGAGAACCCGAGAAG      
51 Mul3SSR53F CAGCTATGACCATGATTACGCC KF031007 124 AAAAC 50.5 Perfect
  Mul3SSR53R GGACCCTTGATGGCATTG      
52 Mul3SSR64F GACGAAAACCGATGAAGAGG KC408230 380 ATGAGC 47.9 Perfect
  Mul3SSR64R GACCGGTAAAACCACACACC      
53 Mul3SSR65F CTGGAGTACAAGAACCGCAAC KC408231 220 GAA 53.8 Perfect
  Mul3SSR65R GCCCTCCACCATTGAACTAAG      
54 Mul3SSR66F GCGAATGATGAAAACGGAGAGG KC408232 262 TTTTA 52.8 Perfect
  Mul3SSR66R GCGGTTAGTTGCCTAGTTGG      
55 Mul3SSR67F ATACCACGTTCCGGTGTG KC408233 304 GT, GA 52.8 Compound
  Mul3SSR67R CATACCGTGCCCCAACTTAC      
56 Mul3SSR70F GAAGAGGGGAGAGGGAGAGA KC408236 187 AAATAA 54.1 Perfect
  Mul3SSR70R CAACCAGGATCCAAATAGAAGC      
57 Mul3SSR71F GGATACTACCTGTTTGGTTGCTG KC408237 360 AAAT, GAA 54.5 Compound
  Mul3SSR71R ATTCCCTCCTCAACGAC      
58 Mul3SSR72F CATCCTTCGAATCCAAGAGC KC408238 231 (AG)TTTACCCAAAGAAT(AG) 50.8 interrupted
  Mul3SSR72R CGAGAGGAAATCCTCACAGC      
59 Mul3SSR73F GGGGAGGTAGCTGATGTGTC KC408239 318 TA, TATT 49.1 Compound
  Mul3SSR73R AGCATGCCCTTCCATATCAC      
60 Mul3SSR74F CCCATTGAGGGTTTTGTGAG KC408240 407 AG, GTGAGC 54.8 Compound
  Mul3SSR74R ATGTGAGCTCGGGATTTGAC      
61 Mul3SSR75F CAGGTTGAACGCCCATTACTC KC408241 102 CT, TCA, TC 47.9 compound
  Mul3SSR75R GTGCAGAATGTCAGTATGCG      
62 Mul3SSR77F ACTCCGCCTGAAGAACGAAG KC408243 254 AGA 54.8 Perfect
  Mul3SSR77R TAGCAGAATCCCCTGTTTGG      
63 Mul3SSR80F GAGCCGTTTGATTTCCGTC KC408245 158 CT 47.9 Perfect
  Mul3SSR80R CAACGGTCGGTGAAAAAGC      
64 Mul3SSR91F CATGAACCGTTGGATCACAG KC408246 277 AG 54.8 Perfect
  Mul3SSR91R ATCCCAGATCCCAAATACCC      
65 Mul3SSR93F CAGCCAATGCACTTTTAACG KC408248 343 AC 49.1 Perfect
  Mul3SSR93R GTGGAGCTTCTGTTGAGC      
66 Mul3SSR94F CCCTCATGTGTTCCATCTACC KC408249 198 AAAACAA 52.8 perfect
  Mul3SSR94R CAGAATCACAGCCGAGGAAG      
67 Mul3SSR95F GATCATCGTGCCAATAAGCC KC408250 209 AG 52.8 perfect
  Mul3SSR95R TAAGAGCTGAGAGGGGAAGC      
68 Mul3SSR97F TCCACCACTGAACCAAATC KC408358 292 GAA 50.8 Perfect
  Mul3SSR97R ATTAGGGTTGTGACGACGAC      
69 Mul3SSR98F ACGACAATGCTGTCGTCTTG KC408252 286 TG 55.2 Perfect
  Mul3SSR98R CGATTCGGAAAGCAAACCAAAC      
70 Mul3SSR99F AGGCAAAGGAGCAGGATG KC408253 272 TTC 58.5 perfect
  Mul3SSR99R GTGGTCACTGCAAAAAGC      
71 Mul3SSR101F TGAGCCAAGACAAGGAGACA KC408255 330 AC 50.8 Perfect
  Mul3SSR101R AGCTAGCAGAATCCCCTTGA      
72 Mul3SSR102F TTGGTTGCTGAGAAATGCAG KC408256 230 AAAT, GAA 55.4 Compound
  Mul3SSR102R TTGTCGATGGAAAACACGAC      
73 Mul3SSR103F GGTCAGATCAGTTTCGTTGC KC408257 258 AG 53.3 Perfect
  Mul3SSR103R GTAAGAGCTGAGAGGGGAAG      
74 Mul3SSR104F GAAGAGCCGACAAAGAATGG KC408258 225 ATGAGC, GCAGAGAA 53.3 Compound
  Mul3SSR104R GGAATGCTTGACCTTTGACC      
75 Mul3SSR105F GCAGAATCCCAAGTTAATGCC KC408259 254 TCT, TGCCAC 57.1 Compound
  Mul3SSR105R CCTCATAGAGTACAGGAACCG      
76 Mul3SSR108F TCTGCCATGGATGCGTGC KC408262 215 CCTCT, TC, TC 54.1 Compound
  Mul3SSR108R GACAGAAACCCGGCAGAAG      
77 Mul3SSR114F GCAACTCTGCCTTGTTTTC KC408266 106 AG 58.5 Perfect
  Mul3SSR114R TGGTGCCTTAGACCAGAC      
78 Mul3SSR116F GATTTTCAGCGCATGGTTC KC408267 382 TTTTA, AATA 58.5 Compound
  Mul3SSR116R CCAAGGAAGGTGAAATCC      
79 Mul3SSR118F CATGAACCGTTGGATCACAG KC408269 277 AG 53.3 Perfect
  Mul3SSR118R ATCCCAGATCCCAAATACCC      
80 Mul3SSR122F GGTGATGGGCTTTTGATG KC408273 219 ATC 51.7 Perfect
  Mul3SSR122R GTTGGATCTGAGGAGGGTC      
81 Mul3SSR124F GGGTGCCAAGGAAAGGA KC408275 228 TCTTTC 54.8 Perfect
  Mul3SSR124R AGAGAGATTCGGCAAAACC      
82 Mul3SSR125F CTTTGATGATGCTTCCTCTGC KC408276 261 CTT, CTA 54.1 Compound
  Mul3SSR125R GTGCACGGAATTTGCTACTG      
83 Mul3SSR126F GGATGCTATTGCCTAAAGTG KC408277 199 AAAAG, AAAAGA 52.8 Compound
  Mul3SSR126R GCAGAATCAGAAGTGTTGTCC      
84 Mul3SSR127F CGATTGCCACATGTTCAGAC KC408278 309 AC 52.8 Perfect
  Mul3SSR127R GGCAGACCCGATAAGCAGTA      
85 Mul3SSR131F ACTGTGCTTCGTGGAGTTG KC408279 305 CT, TCA 55.4 Compound
  Mul3SSR131R GAGAGCTTCGAGAGGGAGG      
86 Mul3SSR135F GATCATCACAAAAAGGCTGG KC408282 137 TC 55.4 Perfect
  Mul3SSR135R GATTGCCGACACTCGTATC      
87 Mul3SSR141F TTGGTGCACTTGCCAAAC KC408286 336 TTTGTT, T 52.8 Compound
  Mul3SSR141R TCACCTCGCATAGACCAC      
88 Mul3SSR142F GCAGAATCCCAAACTTGAGAG KC408287 213 (AG)AAGCTGAAAATGGGGTGT(AG) 54.5 interrupted
  Mul3SSR142R CACAGTTAGCATCACCATGTC      
89 Mul3SSR143F TGCCACCTTCTCCAATATG KC408288 151 TTA 54.5 Perfect
  Mul3SSR143R CGGGAATCGGGATTAAG      
90 Mul3SSR144F GATATGGGAACAAGGGCACTG KC408289 284 CATCAC, ACT 54.5 Compound
  Mul3SSR144R CTGTTTGATGAAGCCATGATG      
91 Mul3SSR145F CCTTCTTCCCCATACCCAC KC408290 165 TCA 50.4 perfect
  Mul3SSR145R CATTTCGGAAGCTTGTCCA      
92 Mul3SSR146F CAACCGATTACATGGTGTGG KC408291 256 CT 50.4 perfect
  Mul3SSR146R TTCCGCAGCAAGCTTTAC      
93 Mul3SSR148F AGGCAATGACAAACGGAAG KC408293 156 CAA 45.1 Perfect
  Mul3SSR148R GCAACCACTTCTGTGTGAGC      
94 Mul3SSR149F TGTCTCTTGGTCAGCGTCTC KC408294 280 (AC)TATACATTCGT(AC) 54.8 interrupted
  Mul3SSR149R CATTTCCCAGAAAGCCACTTC      
95 Mul3SSR150F TCCTGTCTTAGATCGCAACG KC408295 226 TTTTA, AAG 54.8 Compound
  Mul3SSR150R GGTGGCAGGGATTAATGAG      
96 Mul3SSR151F GAGTTTGCAGCCTCAGTATGG KC408296 196 GT, T 54.8 Compound
  Mul3SSR151R CGTGCTTGGAGTAAGGGAAG      
97 Mul3SSR152F TCTCTGTCTGCGCATCAATC KC408297 189 TC 54.5 Perfect
  Mul3SSR152R GCAGAATCCCGATTTTACAG      
98 Mul3SSR153F GGGCATTGTATTGTCCAAGC KC408298 302 TTA 51.7 Perfect
  Mul3SSR153R GAGTAGCCGACATAAATCAGC      
99 Mul3SSR155F ACCCTAAATTGGGACGGAAG KC408300 105 AAG 54.5 Perfect
  Mul3SSR155R CGATTTCTACGAATGCCAGAC      
100 Mul3SSR156F CCCACCCAATCACAATAACC KC408301 190 GAA   Perfect
  Mul3SSR156R GTCAACTCCCGAGCTCAC      
101 Mul3SSR159F CCCAGTTGGGGTTGAGTTG KC408304 108 TTC 51.7 Perfect
  Mul3SSR159R CCTGTCTTGGAGAGGAGAAC      
102 Mul3SSR160F CCCTCTCTCTCGTCGTTCTC KC408305 171 CTT 54.8 Perfect
  Mul3SSR160R CCCACTCAACCCGTTTTATG      
103 Mul3SSR161F TGCATGTACTGGATGATGTG KC408306 166 TGAAG 54.8 Perfect
  Mul3SSR161R CTTTGGCTGTAGAAGCACG      
104 Mul3SSR163F CAGATCTTCTCTCTTGCTCC KC408308 221 CT, CA 54.5 Compound
  Mul3SSR163R GTATGTTTGCTTCACGGCTC      
105 Mul3SSR164F CGGCGGTGGAGAAACAAAG KC408309 393 GA, AAAG, AAAAAG 54.8 Compound
  Mul3SSR164R GTGAACCCCTGTCTTGGATG      
106 Mul3SSR166F AAGAGAACAGTGGCCGTC KC408311 222 ATCACC 54.8 Perfect
  Mul3SSR166R AGGGAAAGGCAAGACTAGGG      
107 Mul3SSR167F CCTTCTTCCCCATACCCAC KC408312 190 TCA 49.1 Perfect
  Mul3SSR167R CACATTTCGGAAGCTTGTCC      
108 Mul3SSR168F CCCTTTAATCCTCTGCCTG KC408313 267 AC 50.4 Perfect
  Mul3SSR168R GCTGATACTTGGGGTTGG      
109 Mul3SSR169F CCAGTTGGGGTTGAGTTGTAAC KC408314 107 TTC 54.8 Perfect
  Mul3SSR169R CCTGTCTTGGAGAGGAGAACC      
110 Mul3SSR170F TAGCTAGCAGATCCCTAC KC408315 241 GT 49.1 Perfect
  Mul3SSR170R GGATTTCGTCGCAACCAT      
111 Mul3SSR171F GGAGGGGTTTTCCTTGAC KC408316 168 GAA 51.7 Perfect
  Mul3SSR171R CGAAGTGGTGCTCTTCAC      
112 Mul3SSR172F GCTAGGCTAAAGCCTGGAAG KC408317 140 TGGATA 54.5 Perfect
  Mul3SSR172R TAGTTCCGGTGACCAACTCC      
113 Mul3SSR173F TCCCGGAACAATCTTATGG KC408318 304 CTT, CTA 54.5 Compound
  Mul3SSR173R CCCTAGTGCACCTTCATTTC      
114 Mul3SSR174F AGCGGTTTCTTGTGAGCAG KC408319 371 A, TTC 54.8 Perfect
  Mul3SSR174R CATAGTTTGGGCCCGTTTAG      
115 Mul3SSR175F GGAAAAGAAAGGGGGAATCAG KC408320 127 GT 54.8 Perfect
  Mul3SSR175R GTCTCCTTTTGGGGATACCA      
116 Mul3SSR177F CACGTACGCAACTTTTTCC KC408322 329 AG 49.1 Perfect
  Mul3SSR177R GTGAGGCTTGACCTGAATG      
117 Mul3SSR178F CAGAGGAGGATATGACATTATCAAC KC408323 202 TC 49.1 Perfect
  Mul3SSR178R CAAACAGAATCCCACACACG      
118 Mul3SSR179F CCAGTTGGGGTTGAGTTGTAAC KC408324 107 TTC 50.4 Perfect
  Mul3SSR179R CCTGTCTTGGAGAGGAGAACC      
119 Mul3SSR180F TCGCCACAATCTTTCACTTG KC408325 335 TCA, TCT 54.8 Compound
  Mul3SSR180R GCGGAGGAATTTTCCATC      
120 Mul3SSR181F CTCTGACATTGGCAAGAAAGC KC408326 282 TTC 51.7 Perfect
  Mul3SSR181R GAGGAACGGCAATAAGAGG      
121 Mul3SSR183F GATCAGGAGAGGAAGGAG JX258829 150 AGA 52.8 Perfect
  Mul3SSR183R CTGTCAAAACCAGCCTTG      
122 Mul3SSR184F CATTCCTGGTGTCAGCCT JX258830 163 (TC)T(TC) 51.7 interrupted
  Mul3SSR184R CAGATCGGCACCAATAGT      
123 Mul3SSR185F AGAGAGCAACCACGGGAAG JX465665 336 AAAAAG 52.8 Perfect
  Mul3SSR185R GTGAACCCCTGTCTTGGA      
124 Mul3SSR187F GGACATTTCACAACCCTG JX465667 324 AAT, CT, AGA 53.8 Compound
  Mul3SSR187R AACTGCAAGTTGGCACAG      
125 Mul3SSR190F AGCTGGGTGGAGGATTG JX465669 283 AC, GCAC 54.8 Compound
  Mul3SSR190R CCACCTCTGCAAGGATTG      
126 Mul3SSR191F CGAATGCATAGAGGGAGAGC JX465670 386 AAAAC 50.4 Perfect
  Mul3SSR191R CACTTGAGGGTTCATTCAGC      
127 Mul3SSR192F GACCTACTTCTCGAACAGTAAC JX465671 198 AAAAC 54.8 Perfect
  Mul3SSR192R CTTGAGGGTTCATTCAGC      
128 Mul3SSR193F GCTAGTTCCATCGCCCATAG JX465672 358 TTGA, TG 51.7 Compound
  Mul3SSR193R GCATCAGATAAAGCAGGTG      
129 Mul3SSR197F GGTGAAAGTTCGTGTGAGTCC JX465674 186 TCT, TC 54.8 Compound
  Mul3SSR197R TCAGCAACTAGAGTGACTTTG      
130 Mul3SSR199F CTCAGGTACGCTGTGCTG JX465675 238 TC 54.8 Perfect
  Mul3SSR199R GACTCAAAGCACATGCCAAG      
131 Mul3SSR201F CCATTGAGGGTTTTGTGAG JX465677 406 GA, GTGAGC 54.8 Compound
  Mul3SSR201R ATGTGAGCTCGGGATTTGAC      
132 Mul3SSR202F CCCTCTCGATCATCACC KC408332 230 TTC 49.1 Compound
  Mul3SSR202R CGGAGACGTAGATGCCC      
133 Mul3SSR203F GACCGTAGGAGAGAGTGC KC408333 442 T, G, CG 54.8 Compound
  Mul3SSR203R GGATACCCGCTAAACCCAC      
134 Mul3SSR205F GCAGTTCCGAATCACGAAATAGG KC408335 216 TTTA 49.1 Perfect
  Mul3SSR205R CAAGGCGAGGTAAACACC      
135 Mul3SSR214F GTGGAACAGGGAGCCAGTCT KC408344 297 GGGCG, GAG, GAGGA 54.8 Compound
  Mul3SSR214R CATGCACGTCTCACTCCAC      
136 Mul3SSR229F CCTTATAGCCGATTTTGCAGGC KC408354 247 TCT 54.8 Perfect
  Mul3SSR229R GAAATTCCGACTCCATGGTC      
137 Mul3SSR230F CGGGTGAGCTGGTTTGTTTC KC408355 298 GT, TG 50.4 Compound
  Mul3SSR230R CAGCCCCACAATCCCTACT