Skip to main content
  • Research article
  • Open access
  • Published:

Identification of novel maize miRNAs by measuring the precision of precursor processing



miRNAs are known to play important regulatory roles throughout plant development. Until recently, nearly all the miRNAs in maize were identified by comparative analysis to miRNAs sequences of other plant species, such as rice and Arabidopsis.


To find new miRNA in this important crop, small RNAs from mixed tissues were sequenced, resulting in over 15 million unique sequences. Our sequencing effort validated 23 of the 28 known maize miRNA families, including 49 unique miRNAs. Using a newly established criterion, based on the precision of miRNA processing from precursors, we identified 66 novel miRNAs in maize. These miRNAs can be grouped into 58 families, 54 of which have not been identified in any other species. Five new miRNAs were validated by northern blot. Moreover, we found targets for 23 of the 66 new miRNAs. The targets of two of these newly identified miRNAs were confirmed by 5'RACE.


We have implemented a novel method of identifying miRNA by measuring the precision of miRNA processing from precursors. Using this method, 66 novel miRNAs and 50 potential miRNAs have been identified in maize.


MiRNAs are known to play crucial roles in the regulation of gene expression in plants [1], including functions such as, leaf polarity, auxin response, floral identity, flowering time, and stress response [27]. MiRNAs are typically ~21 nucleotides in length. In plants, miRNA genes are transcribed by RNA polymerasell into primary miRNA transcripts (pri-miRNA) which can form imperfect stem-loop secondary structure [8, 9]. Then the pri-miRNAs are trimmed and spliced into miRNA/miRNA* duplex by Dicer-like1 (DCL1) with the help of dsRNA binding protein HYL1 and dsRNA methylase HEN1 [1, 1012]. The length of the pre-miRNAs in plants ranges from about 80-nt to 300-nt, and is more variable than in animals. After being transported to the cytoplasm, the mature miRNAs can match to the corresponding target mRNAs through RNA-induced silencing complex (RISC) and the miRNA* are thought to be degraded [1, 13]. MiRNAs regulate their target mRNA either by cleaving in the middle of their binding sites or by translational repression [14, 15]. The plant miRNAs are highly complementary to their targets with about 0~4 nucleotides mismatches [1].

The majority of miRNAs were originally discovered through traditional Sanger sequencing of small RNA pools [1618]. With the advent of second (next) generation sequencing technology, the rate of miRNA discovery increased dramatically [1921]. However, due to the complexity of small RNA population, identification of miRNAs from the small RNA pools of sequencing product was not trivial. Typically, genomic sequences matched to all the small RNA with a length of 19~22-nt were extended upstream and downstream to get a collection of candidate precursors. Their secondary structures were then checked using a number of criteria with Minimum Free Energy (MFE) as the most important one [17, 1921]. The presence of miRNA* has been regarded as a golden standard to reliably annotate a novel miRNA. Nevertheless, miRNA* have only been reported to be showed up with mature miRNA around 10% of the time [22]. As miRNAs can be enriched in certain genomic regions, a clustering algorithm was sometimes used for miRNA identification from large scale small RNA sequencing data. In these studies [2325], hotspots of small RNA generation were identified if they match with multiple known miRNAs; individual hairpin sequences within these hotspots were subsequently checked to see whether some of them could be qualified as miRNAs.

As many miRNAs are conserved among different organisms, sequences of miRNAs found in one species can be used to identify corresponding miRNAs in other species through comparative analysis [6, 26]. However, not all the miRNAs are conserved across different organisms. Direct prediction of potential miRNAs, based on the characteristics of miRNA precursors, has been shown to be a useful approach to identify miRNAs for any organisms, provided that there are a large amount of genomic sequences available [27]. However, as millions, even billions of inverted repeat sequences exist in complex genomes, candidate miRNAs identified just based on computational prediction often show a high rate of false positive.

Maize is an important crop as well as a model of plant genetics. A number of miRNAs with specific function have been reported in maize. The miR172 was reported to target APETALA2 floral homeotic transcription factor that is required for spikelet meristem determination [28]. Also, miR172 functions in promoting vegetative phase transition by regulating the APETALA2-like gene glossy15 [29]. The expression of teosinte glume architecture1 (tga1), which plays an important role in maize domestication, is regulated by miR156 [28]. The miR166 has been found to target a class III homeodomain leucine zipper (HD-ZIPIII) protein that acts on the asymmetry development of leaves in maize [30].

There are a total of 84 unique maize mature miRNAs belonging to 28 miRNA families in the current version of miRBase (release 17) [31]. These 84 miRNAs are the products of 167 precursors. All of these miRNAs were originally identified by searching with known miRNA from other plant species, such as Arabidopsis and rice [3135]. Recently, 150 mature miRNAs from 26 families were validated by Illumina sequencing [34]. To do de novo identification of new miRNAs in maize, we have sequenced small RNAs from mixed tissues, tissues of endosperm and embryo using a next generation sequencing system. Moreover, a new method of identifying novel miRNAs, by measuring the precision of miRNA processing from their precursors, was employed. This method, conceptually proposed by Meyer et al., holds that the precise processing from precursor is both necessary and sufficient criterion for miRNA annotation [36]. We report here the establishment of such a method of identifying miRNAs by measuring the precision of miRNA processing from precursors. This method has resulted in 66 newly identified miRNAs and 50 potential miRNAs in maize. Of the 66 newly identified miRNAs, 62 belong to 54 families that have not been identified before in any other organisms.


Sequencing of maize small RNAs

In order to identify novel miRNAs from maize, four different small RNA samples (two from mixed tissues, one from embryo and another from endosperm) of B73 inbred line were sequenced. The sequencing effort resulted in over 43 million signatures with a length of 18~30nt, representing over 15 million unique sequences (Table 1). The overall size distribution of the sequenced reads from all four sequencing effort were very similar, with the 24-nt class being the most abundant, followed by 22-nt and 21-nt classes (Figure 1). Such a size distribution is consistent with recent report that 22-nt siRNAs were specifically enriched in maize compared with other plants [37, 38]. Although over 43 million sequences were generated, a large number of signatures were only sequenced once, suggesting that maize has a very complex small RNA composition. The percentages of small RNAs sequenced once in four samples were 81.8% (2, 997, 412) and 77.9% (3, 227, 436) in two mixed tissues, 77.5% (5, 339, 164) in endosperm and 78.6% (3, 003, 817) in embryo, respectively. As in other small RNA sequencing efforts, there was a small portion of distinct signatures that matched to mitochondria or chloroplast genomes. In the four independently sequenced samples, there were 4.7%, 5.9%, 7.2% and 19% total signatures that respectively represent 0.26%, 0.50%, 0.49% and 1.2% unique reads matched to non-coding RNAs including tRNA, rRNA, snRNA, snoRNA (Table 2).

Table 1 Summary of small RNA sequencing
Figure 1
figure 1

Small RNA length distribution from four separate sequencing runs.

Table 2 Summary of signatures matched to various RNAs

Validation of known maize miRNAs in miRBase

There are a total of 84 unique mature miRNA sequences belonging to 28 miRNA family in the current miRBase for maize. All these miRNAs were identified by computational method based on sequence conservation using sequences of known miRNAs of other species [3134]. Out of the 84 unique miRNA sequences, 49 can be confirmed by our sequencing effort, while 25 were detected in all four libraries. Except for zma-miR393, zma-miR1432, zma-miR408, zma-miR482 and zma-miR395, 23 of 28 known maize miRNA families had members detected in at least one of the four sequenced libraries. Some of the conserved miRNAs showed very high abundances in our sequenced libraries, for example, zma-miR156a, b, c, d, e, f, g, h and i had more than 20, 000 reads in our four samples (Table 3).

Table 3 Expressional abundance of the known miRNAs calculated in Reads per Million

Sequencing of the four libraries showed that some miRNAs from the current miRNA database may have been mis-annotated. For example, there are two variants for miR166 in the current miRBase. First, zma-miR166b, c, d, e, h, and i are annotated as 22-nt (UCGGACCAGGCUUCAUUCCCC), while zma-miR166a is annotated as 21-nt (UCGGACCAGGCUUCAUUCCC). The 21-nt form has been sequenced 15432, 10857, 19833 and 37037 times respectively in four databases, while the 22-nt form was only sequenced 240, 260, 711 and 476 times. The 21-nt form is nearly one hundred times more abundant than that of 22-nt, therefore we concluded that zma-miR166b, c, d, e, h and i should have the same mature miRNA of 21-nt as zma-miR166a.

Consistent with the general opinion that the miRNA* degrades soon after the biogenesis of mature miRNA, the miRNA* had much less abundance than its corresponding miRNA in the sequencing dataset. Out of 167 miRNA precursors of maize in the current miRBase, 143 had miRNA* annotated. Among the annotated miRNA*, 62 of them could be found in our small RNA sequencing libraries. We also found 10 miRNA* among the remaining 25 precursors that have not been annotated before. The total sequencing abundance of miRNA* in our four libraries was about 0.7% of that of mature miRNAs. However, there were two exceptions where miRNA* had more reads than its corresponding miRNA as reported before [20]. The abundance of the originally annotated miRNA* of zma-miR396a and zma-miR396b was much higher (31, 120, 199, 59 times in four sequenced libraries) than its annotated miRNA (only 16, 9, 38, 20 in the same sequenced libraries). The same thing happened to zma-miR408, whose miRNA was sequenced less than its miRNA*. Both miRNAs had strong conservation among plant species and their target genes validated [39]. This may suggest that a small fraction of miRNA* do not degrade as fast as others.

Novel miRNA identification and target prediction

During the miRNA biogenesis process, the pri-miRNA transcribed by RNA polymerase II is trimmed and spliced into miRNA/miRNA* duplex by Dicer-like1 (DCL1) [1]. The precise enzymatic cleavage of miRNA/miRNA* from the precursor is a key criterion that distinguishes miRNAs from diverse siRNA [36]. We observed that, for most miRNA precursors, there were few small RNA reads other than miRNA and miRNA* that mapped to the precursors. To gain an overall pattern of small RNA distribution along the miRNA precursors, we tested the percentage of small RNA reads mapped to position of mature miRNAs vs. reads mapped to other regions of the same miRNA precursors for all known maize miRNAs. The result showed that out of the 120 known miRNA precursors which had mature miRNA expressed in our four small RNA libraries, 104 (86.7%) had over 75% of the small RNA reads mapped to the exact mature miRNA/miRNA* sites or 4-nt around. Having 75% of reads mapped to the miRNA/miRNA* and its close vicinity had recently been proposed as a primary criterion for valid miRNA annotation. Our result further demonstrated that such a precise processing criterion [36] could be used as a straightforward and reliable method to identify the miRNA from the diverse small RNA data.

To identify novel miRNAs using the method described above, maize genome sequences (downloaded from with known transposons masked were used to generate inverted repeat sequences. A total of 330, 048 inverted repeat sequences with a copy number of no more than 10 in the maize genome were obtained. These inverted repeat sequences were then folded by RNAfold, in both sense and antisense directions, which effectively narrowed down the candidate precursors. Candidate single loop precursors with an overall length of 80-300bp were kept in this study. We then attempted to identify novel miRNAs from our four sequenced RNA samples separately using the precise processing criterion as described in methods (Figure 2). There were 314 sense and 313 antisense RNAs that qualified as miRNA precursor candidates based on the primary criterion. Finally, the secondary structures of these candidates were carefully checked for their validity as miRNA precursors, along with their corresponding mature miRNAs (Figure 3).

Figure 2
figure 2

A pictorial model for the precision of miRNA processing.

Figure 3
figure 3

Flowchart for miRNA prediction.

There were 13 new miRNAs identified from mixed tissues I, 22 from mixed tissues II, 30 from embryo, 38 from endosperm (Table 4). All together we obtained a total of 66 unique new miRNAs. These new miRNAs could be grouped into 58 families (Table 4), given that two miRNAs with less than 4 nucleotides mismatches were grouped into one family. Sixty-two of the 66 newly identified miRNAs belonging to 54 families have not been identified before in any other organisms. Since some of the miRNAs are derived from multiple precursors, the 66 newly identified miRNAs correspond to 70 miRNA precursors. The full information and secondary structure were shown in Additional file 1 and Additional file 2.

Table 4 Summary of the new miRNAs

From the 66 new miRNAs, 16 were sequenced in all four libraries, 17 in three, 15 in two and 18 in one library. The expressions of the 5 newly identified miRNAs were validated by Northern blot using RNAs from kernel of mixed stages (Figure 4). As additional evidence to support the annotation of some of these miRNAs, 22 of the 70 new miRNA precursors were found to have miRNA* in our sequencing data (Additional file 1).

Figure 4
figure 4

Northern blot validation of five new miRNAs.

The 54 miRNA families that were identified for the first time in maize from our sequencing effort provided an opportunity to identify conserved miRNAs that have not yet been discovered in other plant species. After searching the genomes of sorghum, rice and Arabidopsis, we found 17 conserved in sorghum, 14 in rice and 2 in Arabidopsis (Table 5).

Table 5 Conservation of the new miRNA

As most miRNAs are near perfect complementary to their corresponding targeted mRNAs, we performed the target prediction by allowing no more than 3 mismatches between miRNA and its corresponding mRNA sequences [40]. After searching in the annotated maize filtered genes set, we found 41 targeted genes for 23 new miRNAs, 2 of which were validated by 5'RACE. GRMZM2G416426 and GRMZM2G037792 were targeted by miRNA3 and miRNA65, respectively (Figure 5). GRMZM2G416426 was predicted to be an alcohol dehydrogenase 1 (adh1) and GRMZM2G037792 was a GRAS transcription factor. MiRNA65 was identical to miR171a, b, c in Arabidopsis, which is reported to target GRAS transcriptional factor in Arabidopsis [41, 42], suggesting that this miRNA and target pairs were conserved among dicot and monocot plants. A complete list of our predicted miRNAs and their predicted targets are shown in Additional file 3. The target gene GRMZM2G401869 of new miRNA4, was annotated to be a ribosomal protein, reported to be regulated by miR-10a in mouse [43]. MiRNA38 was predicted to target a plant specific abscisic acid (ABA) stress-induced protein (GRMZM2G027241) [44].

Figure 5
figure 5

Two validated new miRNA targets.


Identification of new miRNAs according to the precision of excision from the stem-loop precursor

MiRNAs have been known to play very important post-transcriptional regulation roles throughout plant development. Identifying new miRNA is therefore a critical step towards the understanding of biological regulation. However, small RNA populations in all organisms are extremely complex; while accurate miRNAs identification is not straightforward. Thus far, the majority of reported miRNAs have been identified by "extending method" [17, 1922]. The short reads that resulted from sequencing were mapped to the known reference genome and then candidate precursors were taken by extending upstream and downstream of small map sites. The secondary structures of these extended sequences were then carefully checked for consideration as miRNA precursors. This method typically cost significant computation time, as millions or billions of small RNA sequence generated from sequencing need to be mapped to and extended in the genome individually. For any miRNA precursors, there are other small RNA sequences mapped to 4-nt around the mature miRNA, which often confuse the miRNA annotation. Lacking other supportive information, the appearance of miRNA* is regarded as an essential condition for valid miRNA annotation. However, being degraded after miRNA release, miRNA* has a much lower probability of being sequenced than that of mature miRNA. The annotation of miRNAs based on the appearance of miRNA* would often miss many true miRNAs. As the sequencing becomes relatively easily available with the development of new sequencing technology [45, 46], a robust miRNAs identification system has become increasingly important. In this study, we adopted the primary criterion suggested recently by a large group of scientists in the field of plant miRNA [36]. Our method is based on an assumption that: if any sequences with stem-loop secondary structure have 75% of all small RNAs mapped onto this stem-loop fall in one distinct position (where the miRNA/miRNA* locate), then this hairpin sequences should be annotated as a miRNA precursor [36]. The advantages of our new method are apparent; it saves significant computation time, and the exact sequences of mature miRNAs for all the precursors are easy to determine. However, finding new miRNAs using this method is highly depended on the depth of small RNA sequencing, which is practical only using a next generation sequencing platform. Additionally, our method starting with the prediction of potential miRNA precursors using a very relaxed criterion, it is still possible that some precursors may have been missed, particularly for those of the multi-loop secondary structure.

Although our method relied on the precision of excision from the stem-loop precursors, as demonstrated by the small RNA sequencing data, other cleavage patterns of miRNA precursors, such as the extensive degradome sequencing in rice [47], can also be used to verify miRNA prediction. The elegant degradome sequencing results showed that most conserved miRNA precursors were cleaved precisely at the beginning or end of miRNA/miRNA* duplex.

Additional miRNA candidates

Using this new method, we have identified 66 new miRNAs, 62 of which have not been identified before in any other organism. The discovery of these miRNAs and their targeted genes was a critical step in understanding the complex miRNA regulation network of this important crop.

According to our method, a relative high sequencing depth is required for new miRNAs identification. In our four libraries, unique small RNAs were sequenced an average of 2.6 times. Thus, we have taken 5 as the minimal abundance in the new miRNA prediction. However, some real miRNAs were not sequenced in high enough coverage and were missed. There were 50 small RNAs with a sequencing coverage lower than 5 but higher than 2. At the same time, the corresponding genomic regions of these 50 small RNA fulfill all the criteria for typical miRNA precursors; therefore, these 50 small RNAs are potential miRNA candidates (Additional file 4).

Some miRNA precursors overlap with the protein-coding genes

Based on the maize genome annotation release-5b downloaded from the genome locations of the 167 known and 70 new miRNA precursors were determined. About 18% of the precursors were located within annotated protein coding genes (Figure 6). For those miRNAs that fell on genes, 10% overlapped with exons (sense and anti-sense), and 7% were located in intron regions. This result was consistent with the result reported in P. patens [48], where more than half of the miRNA precursors overlapped with protein coding regions.

Figure 6
figure 6

A pie chart of the distribution of miRNA precursors in the maize genome.

The small RNA population in maize is highly complicated

To identify novel maize miRNA, we conducted four next generation sequencing runs for small RNAs: two mixed tissues, embryo and endosperm. Although we generated over 40 million signatures, sequences from the four databases have a limited overlap, with only 233, 132 unique sequences appeared in all four libraries and a small fraction overlapped between two libraries (Figure 7). This limited overlap indicates a very large number of small RNAs exist in maize.

Figure 7
figure 7

Overlap among four sequenced small RNA libraries.

We noticed that some known miRNAs had very different abundance in the four databases especially between embryo and endosperm: 30 new miRNAs were sequenced either in embryo or endosperm. For example, zma-miR168a, b and zma-miR166a had a very high abundance in the two mixed tissues and the endosperm while they could not be detected in the embryo library, which indicates that they may be endosperm specific. Although their true tissue specificity needs to be further validated through experiments, their relatively high level of expression in embryo or endosperm suggested that they could have important regulatory roles throughout embryo/endosperm development.


We have implemented a novel process of identifying miRNA from small RNA sequencing data by measuring the precision of miRNA processing from precursors. Using this method, 66 novel miRNAs belonging to 54 families have been identified in maize. These newly identified miRNAs can be grouped into 58 families, of which 54 have not been identified in any other species.


Plant Materials and sequencing

B73 inbred was used in our study. Four separated RNA samples were sequenced. Two samples were the mixed tissues of root, stem, leaf, tassel, ear, shoot, pollen and silk. Another two samples were the tissues of endosperm and embryo. The embryo and endosperm were collected 12, 16, 20 and 24 days after pollination. For samples of mixed tissues, RNAs were extracted from 8 tissues separately by using TRIzol reagent (Invitrogen) and then mixed in equally amount for sequencing. The small RNAs of 18-28-nt in length were purified by polyacrylamide gel electrophoresis (PAGE). 3' and 5' adaptors were added for RT-PCR amplification and PCR products were subjected to sequencing. Low quality reads and the adaptor sequences were removed before further analysis.

Data analysis

All the reads generated from sequencing were mapped to the maize genome sequences (release-3b.50, Reads that could not perfectly map to the genome were excluded. RepeatMasker was used to filter the reads from repeat elements. Known non-coding RNAs including tRNA, rRNA, snoRNA, snRNA and other non-coding RNA sequences were annotated by comparing the reads with the Rfam database using BLAST (identity ≥ 80%). The known mature miRNA sequences and precursors were downloaded from miRBase (Release 17.0; Sequences matched to the known miRNA precursors were excluded in the miRNA identification pipeline.

Novel miRNAs identification and target prediction

The maize genome sequences masked with the MIPs repeat were downloaded from B73 genome project [49](release-3b.50, Inverted repeat sequences were extracted by EMBOSS-einverted [50] from the masked genome sequences using parameters "-gap = 20, -threshold = 60, -match = 5, -mismatch = -4, -maxrepeat = 400". As we noticed that a sequence can have different secondary structures in the sense and antisense direction when calculated by RNAfold, the inverted repeat sequences were folded in both directions to retrieve stem-loop sequences with single loops as the candidate miRNA precursors.

We then attempted to identify novel miRNAs from four sequenced RNA samples separately. For each sequenced RNA samples, short reads were first mapped to all the candidate precursors. The precursors that fulfilled the following conditions were selected for further analysis: 1) precursor had at least one unique small RNA of 20~22-nt mapped on it, 2) the unique small RNA had at least five identical reads in a sequencing library, 3) the genomic sequences of the unique small RNA are less than 20 copies in B73 genome. For each selected precursor, a particular position that had the highest number of identical 20-22-nt small RNAs mapped to it was regarded as the potential mature miRNA.

Finally, distributions of reads for all the mapped small RNAs for the selected precursors were checked. If the number of small RNAs mapped around the potential mature miRNA (including 4-nt upstream and downstream) account for 75% of all the reads mapped to the precursors, then the candidate precursor was regarded as a true miRNA precursor, while the most abundant small RNA mapped on it was regarded as the mature miRNA.

After screening by the primary criteria, the secondary structures of the precursors were predicted again by RNAfold [51] using additional parameters. The secondary structures of the inverted repeat should satisfy the following: the MFEI [32](minimum free energy calculated by RNAfold divided by the sequence length) should ≤-0.15; the miRNA candidates should be on the stem of the stem-loop sequences; the candidate miRNA and miRNA* should have no more than 5 mismatches. Inverted repeat sequences that passed all the filters were regarded as our new miRNA precursors, and their corresponding mature miRNAs were the small RNA with the largest abundance among the ones mapped to them.

To find additional evidences for the newly identified miRNAs, the expression of the precursors were tested by BLAST analysis with existing expressed sequence tag (EST) database. We also tried to find the miRNA* in our four small RNA libraries as additional evidence for the annotation of new miRNAs.

To find conserved miRNA in Arabidopsis, rice and sorghum for newly identified miRNAs in maize, genome sequences of Arabidopsis, rice and sorghum,, were downloaded. If the new miRNAs have conserved sequences of no more than 4 mismatches in the genome, we extend the corresponding sequences for further analysis. Two extensions were made: one upstream 30-nt and downstream 300nt, the other upstream 300nt and downstream 30-nt as putative precursors, for the reason that mature miRNA are on the 3' or 5' stem of its precursor. Then the putative miRNA precursors' secondary structures were predicted by RNAfold. If the secondary structure fulfilled the criterion for miRNA precursors, we considered the miRNA conserved in the genome.

The maize annotated coding sequences and Go annotation were downloaded from B73 genome project [49] release-5b). Because most miRNAs were near perfect matches to their corresponding target mRNA, we identify the miRNA target using BLAST with no more than 3 mismatches between miRNA and target sequences.

New miRNA validation by northern blot

The RNA gel blot hybridization was performed as described previously [52]. Total RNA was extracted using RNA pure plant kit (TIANGEN of Beijing, DP437). The low-molecular-weight (LMW) RNA was detected by 15% polyacrylamide gels, blotted onto Hybond N+ membrane (Amersham BioSciences) using the transferring machine (Bio-Rad Laboratories, Mini Trans-Blot) for 1.5 hours at 200 mA, and UV cross-linked. Blot probes for specific small RNAs were labeled using γ-32P-dATP by T4 polynucleotide kinase (NEB, M0201). Blots were prehybridized and hybridized at 37°C for 7 and 24 hours respectively using perfectHyb plus hybridization buffer (Sigma, H7033). Blots were washed at 50°C first with 2 × SSC/0.2% SDS for 15 minutes one time, the second wash was carried out using 1 × SSC/0.1% SDS for 10 minutes, then repeated.

miRNA target validation by 5' RACE

Total RNA was extracted from maize (B73 inbreed) 14 days seedlings, then treated with RQ1 DNase I (Promega) for half an hour. cDNA templates were prepared by following the instruction of SMART RACE kit (Clontech). Two gene-specific primers (GSP1 and NGSP1) were designed by Primer Premier 5.0 software. These two primers were used for two rounds of PCR. Nested PCR products were analyzed on an agarose gel. Positive PCR products were cloned into pEASY-T1(TransGen) vector by use of pEASY-T1 Cloning Kit(TransGen). Each target sequence was confirmed by at least 7 clones.


  1. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116 (2): 281-297. 10.1016/S0092-8674(04)00045-5.

    Article  PubMed  CAS  Google Scholar 

  2. Mallory AC, Vaucheret H: Functions of microRNAs and related small RNAs in plants. Nat Genet. 2006, 38 (Suppl): S31-S36.

    Article  PubMed  CAS  Google Scholar 

  3. Mallory AC, Bartel DP, Bartel B: MicroRNA-directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes. Plant Cell. 2005, 17 (5): 1360-1375. 10.1105/tpc.105.031716.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  4. Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD, Barton MK, Bartel DP: MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region. Embo J. 2004, 23 (16): 3356-3364. 10.1038/sj.emboj.7600340.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  5. Aukerman MJ, Sakai H: Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes. Plant Cell. 2003, 15 (11): 2730-2741. 10.1105/tpc.016238.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  6. Jones-Rhoades MW, Bartel DP: Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell. 2004, 14 (6): 787-799. 10.1016/j.molcel.2004.05.027.

    Article  PubMed  CAS  Google Scholar 

  7. Vaucheret H, Mallory AC, Bartel DP: AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol Cell. 2006, 22 (1): 129-136. 10.1016/j.molcel.2006.03.011.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  8. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN: MicroRNA genes are transcribed by RNA polymerase II. Embo J. 2004, 23 (20): 4051-4060. 10.1038/sj.emboj.7600385.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  9. Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC: Expression of Arabidopsis MIRNA genes. Plant Physiol. 2005, 138 (4): 2145-2154. 10.1104/pp.105.062943.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  10. Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X: Methylation as a crucial step in plant microRNA biogenesis. Science. 2005, 307 (5711): 932-935. 10.1126/science.1107130.

    Article  PubMed  CAS  Google Scholar 

  11. Kurihara Y, Watanabe Y: Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc Natl Acad Sci USA. 2004, 101 (34): 12753-12758. 10.1073/pnas.0403115101.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  12. Vazquez F, Gasciolli V, Crete P, Vaucheret H: The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development, but not posttranscriptional transgene silencing. Curr Biol. 2004, 14 (4): 346-351.

    Article  PubMed  CAS  Google Scholar 

  13. Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS: Nuclear processing and export of microRNAs in Arabidopsis. Proc Natl Acad Sci USA. 2005, 102 (10): 3691-3696. 10.1073/pnas.0405570102.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  14. Llave C, Xie Z, Kasschau KD, Carrington JC: Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science. 2002, 297 (5589): 2053-2056. 10.1126/science.1076311.

    Article  PubMed  CAS  Google Scholar 

  15. Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAS and their regulatory roles in plants. Annu Rev Plant Biol. 2006, 57: 19-53. 10.1146/annurev.arplant.57.032905.105218.

    Article  PubMed  CAS  Google Scholar 

  16. Barakat A, Wall K, Leebens-Mack J, Wang YJ, Carlson JE, Depamphilis CW: Large-scale identification of microRNAs from a basal eudicot (Eschscholzia californica) and conservation in flowering plants. Plant J. 2007, 51 (6): 991-1003. 10.1111/j.1365-313X.2007.03197.x.

    Article  PubMed  CAS  Google Scholar 

  17. Xue LJ, Zhang JJ, Xue HW: Characterization and expression profiles of miRNAs in rice seeds. Nucleic Acids Res. 2009, 37 (3): 916-930. 10.1093/nar/gkn998.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  18. Barakat A, Wall PK, Diloreto S, Depamphilis CW, Carlson JE: Conservation and divergence of microRNAs in Populus. BMC Genomics. 2007, 8: 481-10.1186/1471-2164-8-481.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML: A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach. Genome Res. 2008, 18 (6): 957-964. 10.1101/gr.074740.107.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  20. Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C: A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains. Genome Res. 2008, 18 (9): 1456-1465. 10.1101/gr.075572.107.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  21. Moxon S, Jing R, Szittya G, Schwach F, Rusholme PR, Moulton V, Dalmay T: Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening. Genome Res. 2008, 18 (10): 1602-1609. 10.1101/gr.080127.108.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  22. Rajagopalan R, Vaucheret H, Trejo J, Bartel DP: A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 2006, 20 (24): 3407-3425. 10.1101/gad.1476406.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  23. Heisel SE, Zhang Y, Allen E, Guo L, Reynolds TL, Yang X, Kovalic D, Roberts JK: Characterization of unique small RNA populations from rice grain. PLoS One. 2008, 3 (8): e2871-10.1371/journal.pone.0002871.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH: Clusters and superclusters of phased small RNAs in the developing inflorescence of rice. Genome Res. 2009, 19 (8): 1429-1440. 10.1101/gr.089854.108.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  25. Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ: Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa. Genome Res. 2008, 18 (4): 571-584. 10.1101/gr.6897308.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  26. Bonnet E, Wuyts J, Rouze P, Van de Peer Y: Detection of 91 potential conserved plant microRNAs in Arabidopsis thaliana and Oryza sativa identifies important target genes. Proc Natl Acad Sci USA. 2004, 101 (31): 11511-11516. 10.1073/pnas.0404025101.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  27. Lindow M, Jacobsen A, Nygaard S, Mang Y, Krogh A: Intragenomic matching reveals a huge potential for miRNA-mediated regulation in plants. PLoS Comput Biol. 2007, 3 (11): e238-10.1371/journal.pcbi.0030238.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Chuck G, Meeley R, Irish E, Sakai H, Hake S: The maize tasselseed4 microRNA controls sex determination and meristem cell fate by targeting Tasselseed6/indeterminate spikelet1. Nat Genet. 2007, 39 (12): 1517-1521. 10.1038/ng.2007.20.

    Article  PubMed  CAS  Google Scholar 

  29. Lauter N, Kampani A, Carlson S, Goebel M, Moose SP: microRNA172 down-regulates glossy15 to promote vegetative phase change in maize. Proc Natl Acad Sci USA. 2005, 102 (26): 9412-9417. 10.1073/pnas.0503927102.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  30. Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC: microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature. 2004, 428 (6978): 84-88. 10.1038/nature02363.

    Article  PubMed  CAS  Google Scholar 

  31. Griffiths-Jones S: miRBase: microRNA sequences and annotation. Curr Protoc Bioinformatics. 2010, Chapter 12: 12-19.

    Google Scholar 

  32. Zhang BH, Pan XP, Cox SB, Cobb GP, Anderson TA: Evidence that miRNAs are different from other RNAs. Cell Mol Life Sci. 2006, 63 (2): 246-254. 10.1007/s00018-005-5467-7.

    Article  PubMed  CAS  Google Scholar 

  33. Christopher M, Marja T, Lincoln S, Doreen W: Identifying MicroRNAs in Plant Genomes. Proc IEEE CSB. 2004, 718-723.

    Google Scholar 

  34. Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D: A genome-wide characterization of microRNA genes in maize. PLoS Genet. 2009, 5 (11): e1000716-10.1371/journal.pgen.1000716.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Zhang B, Pan X, Anderson TA: Identification of 188 conserved maize microRNAs and their targets. Febs Lett. 2006, 580 (15): 3753-3762. 10.1016/j.febslet.2006.05.063.

    Article  PubMed  CAS  Google Scholar 

  36. Meyers BC, Axtell MJ, Bartel B, Bartel DP, Baulcombe D, Bowman JL, Cao X, Carrington JC, Chen X, Green PJ, et al: Criteria for annotation of plant MicroRNAs. Plant Cell. 2008, 20 (12): 3186-3190. 10.1105/tpc.108.064311.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  37. Nobuta K, Lu C, Shrivastava R, Pillay M, De Paoli E, Accerbi M, Arteaga-Vazquez M, Sidorenko L, Jeong DH, Yen Y, et al: Distinct size distribution of endogeneous siRNAs in maize: Evidence from deep sequencing in the mop1-1 mutant. Proc Natl Acad Sci USA. 2008, 105 (39): 14958-14963. 10.1073/pnas.0808066105.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  38. Wang X, Elling AA, Li X, Li N, Peng Z, He G, Sun H, Qi Y, Liu XS, Deng XW: Genome-wide and organ-specific landscapes of epigenetic modifications and their relationships to mRNA and small RNA transcriptomes in maize. Plant Cell. 2009, 21 (4): 1053-1069. 10.1105/tpc.109.065714.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  39. Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL: Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis. Plant Cell. 2005, 17 (8): 2186-2203. 10.1105/tpc.105.033456.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  40. Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK: Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biol. 2008, 8: 25-10.1186/1471-2229-8-25.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, Krizan KA, Carrington JC: P1/HC-Pro, a viral suppressor of RNA silencing, interferes with Arabidopsis development and miRNA unction. Dev Cell. 2003, 4 (2): 205-217. 10.1016/S1534-5807(03)00025-X.

    Article  PubMed  CAS  Google Scholar 

  42. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP: MicroRNAs in plants. Genes Dev. 2002, 16 (13): 1616-1626. 10.1101/gad.1004402.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  43. Orom UA, Nielsen FC, Lund AH: MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. Mol Cell. 2008, 30 (4): 460-471. 10.1016/j.molcel.2008.05.001.

    Article  PubMed  Google Scholar 

  44. Guo WJ, Ho TH: An abscisic acid-induced protein, HVA22, inhibits gibberellin-mediated programmed cell death in cereal aleurone cells. Plant Physiol. 2008, 147 (4): 1710-1722. 10.1104/pp.108.120238.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  45. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen YJ, Chen Z, et al: Genome sequencing in microfabricated high-density picolitre reactors. Nature. 2005, 437 (7057): 376-380.

    PubMed  CAS  PubMed Central  Google Scholar 

  46. Shendure J, Ji H: Next-generation DNA sequencing. Nat Biotechnol. 2008, 26 (10): 1135-1145. 10.1038/nbt1486.

    Article  PubMed  CAS  Google Scholar 

  47. Li YF, Zheng Y, Addo-Quaye C, Zhang L, Saini A, Jagadeeswaran G, Axtell MJ, Zhang W, Sunkar R: Transcriptome-wide identification of microRNA targets in rice. Plant J. 2010, 62 (5): 742-759. 10.1111/j.1365-313X.2010.04187.x.

    Article  PubMed  CAS  Google Scholar 

  48. Axtell MJ, Snyder JA, Bartel DP: Common functions for diverse small RNAs of land plants. Plant Cell. 2007, 19 (6): 1750-1769. 10.1105/tpc.107.051706.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  49. Schnable PS, Ware D, Fulton RS, Stein JC, Wei F, Pasternak S, Liang C, Zhang J, Fulton L, Graves TA, et al: The B73 maize genome: complexity, diversity, and dynamics. Science. 2009, 326 (5956): 1112-1115. 10.1126/science.1178534.

    Article  PubMed  CAS  Google Scholar 

  50. Rice P, Longden I, Bleasby A: EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000, 16 (6): 276-277. 10.1016/S0168-9525(00)02024-2.

    Article  PubMed  CAS  Google Scholar 

  51. Hofacker IL: Vienna RNA secondary structure server. Nucleic Acids Res. 2003, 31 (13): 3429-3431. 10.1093/nar/gkg599.

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  52. Lu C, Tej SS, Luo S, Haudenschild CD, Meyers BC, Green PJ: Elucidation of the small RNA component of the transcriptome. Science. 2005, 309 (5740): 1567-1569. 10.1126/science.1114112.

    Article  PubMed  CAS  Google Scholar 

Download references


This work is supported by the 973 project (2009CB118400) from the Ministry of Science and Technology. We also would like to thank Dr. Eric W. Linton for his critical review of the manuscript.

Author information

Authors and Affiliations


Corresponding author

Correspondence to Jinsheng Lai.

Additional information

Authors' contributions

JL designed the research. YJ did the data analysis. WS and MZ performed the sample preparation and experimental validation. JL and YJ wrote the paper. All the authors have read and approved the final manuscript.

Yinping Jiao, Weibin Song, Mei Zhang contributed equally to this work.

Electronic supplementary material


Additional file 1: new miRNA precursors. new miRNA precursors. the location of the new miRNA precursors in maize genome (XLS 28 KB)


Additional file 2: secondary structure of the newly identified miRNA precursors. the secondary structure of the newly identified miRNA precursors. the secondary structure of the newly identified miRNA precursors. (PDF 58 KB)


Additional file 3: the target gene of new miRNA1. the target gene of new miRNA. the target gene and annotation of new miRNAs (XLS 23 KB)


Additional file 4: candidate miRNA precursors. candidate miRNA precursors. the location of the candidate miRNA precursors in maize genome (XLS 32 KB)

Authors’ original submitted files for images

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Jiao, Y., Song, W., Zhang, M. et al. Identification of novel maize miRNAs by measuring the precision of precursor processing. BMC Plant Biol 11, 141 (2011).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:
