Skip to main content

GSTU43 gene involved in ALA-regulated redox homeostasis, to maintain coordinated chlorophyll synthesis of tomato at low temperature

Abstract

Background

Exogenous 5-aminolevulinic acid (ALA) positively regulates plants chlorophyll synthesis and protects them against environmental stresses, although the protection mechanism is not fully clear. Here, we explored the effects of ALA on chlorophyll synthesis in tomato plants, which are sensitive to low temperature. We also examined the roles of the glutathione S-transferase (GSTU43) gene, which is involved in ALA-induced tolerance to oxidation stress and regulation of chlorophyll synthesis under low temperature.

Results

Exogenous ALA alleviated low temperature caused chlorophyll synthesis obstacle of uroporphyrinogen III (UROIII) conversion to protoporphyrin IX (Proto IX), and enhanced the production of chlorophyll and its precursors, including endogenous ALA, Proto IX, Mg-protoporphyrin IX (Mg-proto IX), and protochlorophyll (Pchl), under low temperature in tomato leaves. However, ALA did not regulate chlorophyll synthesis at the level of transcription. Notably, ALA up-regulated the GSTU43 gene and protein expression and increased GST activity. Silencing of GSTU43 with virus-induced gene silencing reduced the activities of GST, superoxide dismutase, catalase, ascorbate peroxidase, and glutathione reductase, and increased the membrane lipid peroxidation; while fed with ALA significant increased all these antioxidase activities and antioxidant contents, and alleviated the membrane damage.

Conclusions

ALA triggered GST activity encoded by GSTU43, and increased tomato tolerance to low temperature-induced oxidative stress, perhaps with the assistance of ascorbate- and/or a glutathione-regenerating cycles, and actively regulated the plant redox homeostasis. This latter effect reduced the degree of membrane lipid peroxidation, which was essential for the coordinated synthesis of chlorophyll.

Background

Plants exposed to low temperature exhibit a short-term stress response involved modification of gene expression and levels of plant hormones, increased cross-talk signaling, and accumulation of osmolytes and antioxidants, presumably to protect against long-term damage [1]. Extended exposure to low temperature damages DNA and protein, causes lipid peroxidation, and results in general physiological and metabolic disturbances that reduce growth and vigor [2].

It is well-known that exogenous application of 5-aminolevulinic acid (ALA) improves plant tolerance to environmental stress [3,4,5,6,7,8,9]. This compound is also the precursor to porphyrins, which are, in turn, the precursors to plant pigments, including heme and chlorophyll; as such, application of ALA increased the chlorophyll content of plants [8, 10, 11]. In a previous study, we observed that ALA improved perception of, and tolerance to, oxidative stress imposed by low temperature. We attributed this to the accumulation of glutathione (GSH) and ascorbate (AsA) [12].

The tripeptide glutathione (GSH; composed of γ-Glu-Cys-Gly) is an antioxidant with a central role in the regulation of redox balance and signaling [13,14,15,16]. Plants contain several GSH-dependent detoxifying enzymes [17, 18], most notably glutathione S-transferases (EC 2.5.1.18, GSTs). GSTs are an evolutionarily ancient, large, and diverse family. GSTs have catalytic functions and non-catalytic functions (such as binding and transport of secondary metabolites and hormones), which related to their structural dynamics [19].

Many studies have shown that GSTs play crucial roles in mediating plant perception of, and tolerance to, abiotic stress. For example, induction of GSTs by salicylic acid (SA) [20] or their over-expression [21] sustained tomato redox homeostasis when plants were exposed to salt stress. Also, when the drought-tolerant Prosopis juliflora (PjGSTU1) gene was introduced into tobacco, its peroxidase activity reduced excess reactive oxygen species (ROS) and maintained the redox balance in drought-stressed plants [22]. In other studies, the over-expression of a tobacco U class of GSTs elevated the GST activity, apparently increasing the levels of antioxidants sufficiently to permit tobacco seedlings [23] to cope with salt and chilling stress and to permit rice plants to cope with low temperature stress [24]. The non-catalytic functions of GSTs may also be important in stress tolerance. GSTs could bind and/ or conjugate metabolites such as porphyrins [25], phytohormones [26], and other secondary metabolites [27], and then transport them to perform function or protect against cellular oxidation [19].

The metabolism of porphyrins, central to the synthesis of chlorophyll and heme, is carefully regulated in the chloroplast. In healthy cells, the integrated membrane system and conjugated protein provide guarantee for chlorophyll synthesis [28]. However, the membranes and conjugated protein of stressed cells may be damaged by peroxides, and under this circumstance porphyrins could leak into the cytosol [19, 25, 29]. If so, they would be oxidized to the lipophilic and phytotoxic protoporphyrin, exacerbating the already damaging effect of peroxide accumulation in stressed cells [25, 29]. The ZmGSTU1 of maize, bound porphyrinogens that had leaked from chloroplasts under oxidative stress, preventing their auto oxidation and apparently protecting the cells from oxidative stress [29].

Tomatoes are sensitive to low temperatures (8 °C–15 °C), in the winter and early spring in China. Low temperature can severely limit the growth and yield of tomatoes. Many studies have illustrated that exogenously applied ALA reduced ROS accumulation by increasing antioxidant ability under abiotic stress [30,31,32,33]. Our preliminary studies showed that ALA induced early H2O2 signaling under normal conditions, which then interacted with JA, induced the downstream NO, regulated the redox state, resulting in elevated antioxidant capacity and photosynthesis in tomato plants under low temperature [12, 34]. This was accompanied by ALA-induced up-regulation of the GSTU43 gene (Additional file 2: Fig. S1), which encodes a GST. These results inspired us to ask: What is the relationship between redox homeostasis and porphyrin synthesis regulated by exogenous ALA during low temperature stress? What is the role of GSTU43 in the maintenance of redox homeostasis at low temperature? So, in this study, we first assessed the effect of exogenous ALA on chlorophyll synthesis and GST activity encoded by GSTU43 in tomato leaves. And we further explored whether GSTU43 involved in ALA-mediated redox status and alleviation of membrane lipid peroxidation, which was crucial for the coordinated chlorophyll synthesis.

Methods

Treatment with exogenous ALA and Gabaculine

Tomato (Solanum lycopersicum cv. Jinpeng no. 1, which is sensitive to low temperature stress) seeds (purchase from Xi’an Jinpeng Seedlings Co., Ltd. Shaanxi, China.) were used in this study. Seedlings cultivation was according to our previous study [12]. When the fifth true leaves were completely expanded, plants of similar appearance were selected for the experiments.

We wished to compare the effects of exogenous ALA on chlorophyll synthesis, expression of GSTU43 and GST activity in plants exposed to low and normal temperature. Plants were sprayed with 6 mL either distilled water or 25 mg·L− 1 ALA (Sigma-Aldrich, St. Louis, MO, USA) solution [12], containing a few drops of Tween-20, 1.5 h before the night. Twelve hours later, half of ALA-treated and untreated plants were kept at normal temperatures (25 °C/18 °C, day/night) while the rest of the plants were exposed to a low-temperature regime: 15 °C during the photoperiod and 8 °C during the dark, with the same relative humidity and light period as the normal-temperature plants.

To determine whether exogenous ALA-induced GSTU43 up-regulation and GST activity is due to endogenous ALA. The tomato leaves were pretreated with 100 μM Gabaculine (GAB, inhibition of ALA synthesis that inactivates glutamate-1-semialdehyde aminotransferase) [35, 36]. After 8 h, the leaves were sprayed with distilled water or 25 mg·L− 1 ALA. Twelve hours later, the plants were exposed to low temperatures. After 24 h low temperatures, the GSTU43 gene expression and protein levels, and GST activity were measured.

VIGS plants and experiments

To prepare the pTRV2-GSTU43 vectors, a 294 bp fragment of GSTU43 was amplified with PCR using the forward primer GCTCTAGAATGCCAGTAATGGGGAAAGC and the reverse primer GGGGTACCTCTTGGCGGTAAATATTCCTTG; the primers contained XbaI and KpnI restriction sites. The PCR fragment was inserted into the XbaI and KpnI site of pTRV2 vector. The pTRV2-GSTU43 VIGS constructs were confirmed by sequencing. Then, Agrobacterium tumefaciens strain GV3101 was transformed with pTRV2-GSTU43 as described by Cheng et al. [37]. Agrobacterium-mediated virus infection was performed as described of Ekengren et al. [38], when two cotyledons of tomato seedlings (cv. Jinpeng no. 1), cultivated as our previous study [12], completely expanded. An Agrobacterium culture carrying an empty pTRV2 vector was also infiltrated into a set of plants that served as a control. The inoculated plants were maintained at 20–22 °C in a growth chamber with relative humidity of 60% ± 5%, and a two-phase photoperiod of 12.5 h with a PPFD of 350 μmol photons·m− 2·s− 1 followed by 1.5 h with a PPFD of 50 μmol photons·m− 2·s− 1); the photoperiod was followed by a 10-h dark period. The temperature and light period were set according to the description of Cheng et al. [37] and our preliminary experiment. After 35 days, the gene silencing efficiency was assessed with quantitative real-time PCR (qRT-PCR) before the plants were used in assays. And then, plants of similar appearance were selected for the experiments.

The plants were pre-treated with exogenous ALA, then exposed to normal condition (22 °C/20 °C, day/night) or low temperature (15 °C/8 °C, day/night) 12 h later. After 24 h of low temperature, malondialdehyde (MDA) content, relative electrical conductivity (REC), H2O2 content, maximal quantum yield of PSII photochemistry (Fv/Fm), antioxidase and antioxidants levels, expression of GSTU43 gene of VIGS plants were measured. Frozen samples were collected for the measurement of MDA, H2O2, antioxidases, antioxidants, and gene expression, while fresh samples were used for the REC and Fv/Fm analysis. Samples for plant dry weight were taken 6 d after the start of the low temperature treatment.

Leaf samples were collected at different times after the start of the temperature treatment, frozen immediately in liquid nitrogen, and stored at − 80 °C until needed. Fresh leaf samples were harvested for measuring the chlorophyll and related compounds, plant dry weight, and Fv/Fm and REC. All the experiments were repeated for three times, and three independent biological replicates for each time.

Measurement of plant dry weight

Plants were rinsed three times with distilled water, oven dried at 105 °C for 15 min, and then at 75 °C for 72 h to obtain dry weights.

Chlorophyll synthesis analysis

Chlorophyll was extracted from the fifth fully expanded leaf in acetone, ethanol, and water (4.5: 4.5: 1, v/v/v) and pigments were analyzed spectrophotometrically based on the absorbance at 450, 645, and 663 nm [39]. The content of ALA was determined according to the methods of Morton [40]. The porphobilinogen (PBG) and UROIII content were measured according to the methods of Bogorad [41]. The Proto IX, Mg-protoporphyrin IX (Mg-proto IX) and protochlorophyll (Pchl) were all carried out according to the methods of Hodgins and Van Huystee [42]. All the details for determining these chlorophyll precursors above were described in our previous studies [43].

Membrane lipid peroxidation assays

The H2O2 content was obtained via monitoring the absorbance at 412 nm [44], as described in our previous study [12]. Using the methods of Hodges et al. [45], and Zhou and Leul [46] to determine the MDA content and REC, respectively. Fv/Fm was assayed as described in our previous study [12, 47], and the plants were subjected to dark for 30 min before determination.

Antioxidant assays

The activity of superoxide dismutase (SOD; EC 1.15.1.1) was conducted using the method of Giannopolitis and Ries [48]. The activities of catalase (CAT; EC 1.11.1.6), glutathione reductase (GR; EC 1.6.4.2), ascorbate peroxidase (APX; EC 1.11.1.11), monodehydroascorbate reductase (MDHAR; EC 1.6.5.4), dehydroascorbate reductase (DHAR; EC 1.8.5.1), and the contents of glutathione and ascorbate were assayed as described in our previous study [12, 49]. The GST activity was measured using GSH-ST assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the supplier’s instruction.

Gene expression analyses

For RNA sequencing experiments, the tomato leaves, treated with ALA or/ and temperature, were collected and frozen immediately in liquid nitrogen, and stored at − 80 °C until needed. And then, the RNA sequencing were carried out using Illumina High-Seq platform at Biomarker Technologies Corporation (Beijing, China). The total RNA extracted and qRT-PCR analyses were conducted according to our previous descriptions [34] using two different reference genes, actin7 and GAPDH [50], and the relative gene expression was calculated following Livak and Schmittgen [51]. The gene specific primers are listed in Additional file 1: Table S1.

Protein extraction and western blotting

The protein extraction and western blotting according to the methods of Zhou et al. [52] with a modification. Briefly, for protein extraction, tomato leaves, collected 24 h after low temperature treatment, were ground in liquid nitrogen, and homogenized in extraction buffer (50 mM Tris-HCl, pH 7.5, containing, 150 mM NaCl, 2 mM EDTA-Na2, 10% glycerol, 1% Triton X-100, 1 mM PMSF and 1 mM DTT). The extracts were centrifuged at 12,000 g for 20 min, and the extracted protein was heated at 95 °C for 15 min, then separated using 10% SDS-PAGE. For western blotting, the proteins on the SDS-PAGE gel were transferred to a polyvinylidene-fluoride membrane. The membrane was blocked for 12 h at 4 °C in 1 × BLOK BSA in PBS [Sangon Biotech (Shanghai) Co., Ltd], then incubated for 4 h in antibody dilution buffer and a rabbit anti-GSTU43 polyclonal antibody [Genscript (Nanjing) Co., Ltd.], or a rabbit antiactin polyclonal antibody (Abcam). And then the membrane was incubated with a goat anti-rabbit HRP-conjugated antibody (Cell Signaling Technology). Accumulation of actin and GSTU43 were quantified using Image Lab 6.0 software (Bio-Rad, Hercules, CA, USA).

Statistical analysis

All data were subjected to analysis of variance (ANOVA) using SAS 8.0 software (SAS Institute, Cary, NC, USA). Significant difference was assessed using Tukey’s test at a significance level of P < 0.05, unless stated otherwise.

Results

ALA regulated chlorophyll synthesis in low temperature-stressed tomato leaves

ALA is a precursor in the chlorophyll biosynthetic pathway. Exogenous application of ALA has been shown to increase the chlorophyll content in leaves of crop species [6, 33, 53], so we began this study by measuring the effect of exogenous ALA on the chlorophyll content and other related compounds (precursors) in low temperature-stressed tomato leaves compared to leaves from unstressed plants (Figs. 1 and 2).

Fig. 1
figure 1

ALA induced kinetic changes of chlorophyll content in tomato leaves within 96 h after imposition of low temperature. The tomato leaves treated with distilled water or 25 mg·L− 1 ALA then exposed to normal condition (control and ALA) or low temperature (LT and LTA) 12 h later. The chlorophyll (Chl) content were measured when the low temperature started. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). Fw, fresh weight

Fig. 2
figure 2

ALA induced kinetic changes of chlorophyll precursors in the chlorophyll biosynthetic pathway in tomato leaves within 96 h after imposition of low temperature. The tomato leaves treated with distilled water or 25 mg·L− 1 ALA then exposed to normal condition (control and ALA) or low temperature (LT and LTA) 12 h later. The precursor content were measured when the low temperature started. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). ALA, 5-aminolevulinic acid; PBG, porphobilinogen; UROIII, uroporphyrinogen III; Proto IX, protoporphyrin IX; Mg-proto IX, Mg-protoporphyrin IX; and Pchl, protochlorophyll

In plants grown in normal temperature (25 °C/18 °C), exogenous ALA had no obvious effect on either chlorophyll or endogenous ALA levels, while there were more PBG, UROIII, Proto IX, Mg-proto IX, and Pchl at 72 and 96 h in ALA-treated plants than in untreated controls. Low temperature treatment (15 °C/8 °C) by itself decreased the amounts of chlorophyll and most of the precursors, but dramatically increased PBG, UROIII, and the ratio of Chl a/b, apparent 48 h after treatment was started. However, when low temperature-stressed plants received exogenous ALA, there was markedly less PBG and UROIII, and more of the other precursors and chlorophyll after 48 h than the low temperature-stressed plants alone.

We performed qRT-PCR to analyze the genes expression of the key enzymes involved in chlorophyll biosynthetic pathway. Under normal condition, application of ALA had no obvious effect on aminolevulinic dehydratase (ALAD) expression at any time, but dramatically elevated the transcription of other genes at different times: specifically, expression of porphobilinogen deaminase (PBGD) was elevated before 6 h, uroporphyrinogen decarboxylase (UROD) at 3 h and 48 h, coproporphyrinogen III oxidase (CPOX) and protoporphyrinogen IX oxidase (PPOX) at 0 h, 3 h, and 48 h, Mg-protoporphyrin IX methyltransferase (CHLM) within 3 h, protochlorophyllide oxidoreductase (POR) at 0 h, and chlorophyll synthase (CHLG) at 0 h, 24 h, and 48 h (Fig. 3). Expression of chlorophyllide a oxygenase (CAO) at 0 h, 3 h, 6 h, and 24 h, UROD at 12 h, CPOX at 12 h and 24 h, PPOX at 6 h and 12 h, respectively, in ALA-treated leaves were lower than in the control. When exogenous ALA was supplied before low temperature stress, the genes expression of PBGD, CPOX, PPOX, CHLM, POR, and CHLG were significantly up-regulated at 0 h, and then decreased expression of these genes after 3 h, while UROD transcript was up-regulated at 3 h and down-regulated at 12 h and 24 h, respectively, compared to low temperature-stressed plants alone.

Fig. 3
figure 3

ALA induced kinetic changes of gene expression in chlorophyll synthesis with tomato leaves under low temperature within 48 h. The tomato leaves treated with distilled water or 25 mg·L− 1 ALA then exposed to normal condition (control and ALA) or low temperature (LT and LTA) 12 h later. The expression of genes were carried out when the low temperature started. The gene transcription levels in control plants at 0 h was normalized as 1. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). ALAD, aminolevulinic dehydratase gene; PBGD, porphobilinogen deaminase gene; UROD, uroporphyrinogen decarboxylase gene; CPOX, coproporphyrinogen III oxidase gene; PPOX, protoporphyrinogen IX oxidase gene; CHLM, Mg-protoporphyrin IX methyltransferase gene; POR, protochlorophyllide oxidoreductase gene; CHLG, chlorophyll synthase gene; CAO, chlorophyllide a oxygenase gene

These results showed that low temperature disrupted chlorophyll synthesis and hindered URO III conversion to Proto IX, and that exogenous ALA counteracted the disruptive effect of low temperature. However, this pattern was not apparent in gene expression, indicating that ALA may regulate chlorophyll synthesis at a level other than transcription [54, 55].

ALA positively induced the GSTU43 gene and protein expression, and GST activity in tomato at low temperature

Glutathione S-transferases regulate the redox balance and improve plant oxidation resistance [19]. We observed that GSTU43 was significantly up-regulated by ALA using RNA-seq in tomato (Additional file 2: Figure S1), and we also verified the expression of GSTU43 and its associated GST activity. In this study, ALA significantly raised the GSTU43 expression since 6 h, and increased GST activity was apparent at 24 h and 48 h (Fig. 4a and b). This elevation was apparent in both temperature treatments. In normal temperatures, ALA increased GSTU43 transcription by 121 and 224%, and the activity of GST by 18.9 and 45.9%, at 24 h and 48 h, respectively. When the plants were low temperature-stressed, GSTU43 expression was increased 154 and 132%, and GST activity was increased 33.2 and 33.6% at 24 h and 48 h, respectively.

Fig. 4
figure 4

ALA induced changes of glutathione S-transferase (GSTU43) gene and protein expression and GST activity in tomato leaves under low temperature within 48 h. The tomato leaves treated with distilled water or 25 mg·L− 1 ALA then exposed to normal condition (control and ALA) or low temperature (LT and LTA) 12 h later. The expression of GSTU43 (the gene transcription levels in control plants at 0 h was normalized as 1) (a) and GST activity (b) were carried out when the low temperature started. The tomato leaves were pretreated with 100 μM Gabaculine (GAB, inhibition of ALA synthesis that inactivates glutamate-1-semialdehyde aminotransferase). After 8 h, the leaves were sprayed with distilled water or 25 mg·L− 1 ALA. Twelve hours later, the plants were exposed to low temperatures. After 24 h low temperatures, the GSTU43 gene expression (the gene transcription levels in control plants at 24 h was normalized as 1) (c) and GST activity (d), and protein levels (e) were measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05)

Compared with control plants under normal or low temperature stress alone, fed with ALA dramatically improved GSTU43 gene and protein expression, and GST activity (Fig. 4c, d and e). Compared with control plants, GAB treatment further provoked a significant increase of GSTU43 gene and protein expression, and GST activity by 290, 212 and 67.8%, respectively, under normal temperature; while GAB plus low temperature triggered an increase of GSTU43 gene and protein expression, and GST activity 603, 108 and 46.9% increase, respectively, compared to low temperature treatment alone. GAB plus ALA treatment dramatically decreased the GAB triggered GSTU43 gene and protein expression, and GST activity, under normal or low temperature.

GSTU43 is involved in ALA- induced low temperature tolerance

We silenced GSTU43 with VIGS to assess the function of GSTU43 in ALA-induced low temperature tolerance. The average silence efficiency was about 68.9% (Additional file 3: Figure S2a). Under low temperature, the dry weight of low temperature-stressed, GSTU43 silenced plants was 15.0% less than the pTRV plant, and supplementing the GSTU43 silenced, low temperature-stressed plants with ALA restored the dry weight to the pTRV level (Additional file 3: Figure S2b).

We also assessed membrane lipid peroxidation damage. We observed no effect of exogenous ALA on levels of MDA and REC, or on Fv/Fm in pTRV-GSTU43 plants grown at normal temperatures (Fig. 5). Low temperatures resulted in accumulation of MDA, elevated REC, and reduced Fv/Fm compared to normal temperature. The differences were most striking in the low temperature-stressed, pTRV-GSTU43 plants; ALA reversed the effects of silencing and restored the values to those of the pTRV low temperature-stressed plants (Fig. 5).

Fig. 5
figure 5

Effects of exogenous ALA on membrane peroxidation injury in partial GSTU43-silenced tomato leaves under low temperature. a malondialdehyde (MDA) levels, (b) relative electrical conductivity (REC), (c) maximal quantum yield of PSII photochemistry (Fv/Fm). The VIGS plants leaves were treated with distilled water or 25 mg·L− 1 ALA, then exposed to normal condition (22 °C/20 °C, day/night) or low temperature (15 °C/8 °C, day/night) 12 h later. After 24 h of low temperature, these indexes were measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05)

Silencing of GSTU43 compromised ALA- induced enhancement in antioxidant capacity

Redox homeostasis is important for plant growth and development [56, 57], and we have shown that ALA positively regulates the redox state of tomato via the accumulation of GSH and AsA, mediated by H2O2 [12]. We further investigated the role of GSTU43 in ALA-induced oxidative stress tolerance of tomato under low temperature by assessing the expression of GSTU43, and the level of antioxidant and activities of antioxidases. Under normal temperatures, ALA treated plants showed higher GSTU43 expression and GST activity than the plants without ALA treated (Fig. 6).

Fig. 6
figure 6

ALA induced GSTU43 expression and GST activity in partial GSTU43-silenced plants exposed to low temperature. a GSTU43 expression. The gene transcription levels in pTRV plants under normal condition at 24 h was normalized as 1, (b) GST activity. The VIGS plants leaves were treated with distilled water or 25 mg·L− 1 ALA, then exposed to normal condition (22 °C/20 °C, day/night) or low temperature (15 °C/8 °C, day/night) 12 h later. After 24 h of low temperature, these indexes were measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05)

We next examined these parameters in low temperature-stressed plants. Expression of GSTU43 and GST activity in pTRV-GSTU43 plants exposed to low temperature was significantly less than in low temperature-stressed pTRV plants. In low temperature-stressed pTRV-GSTU43 plants treated with ALA, GSTU43 expression increased by 335%, and GST activity increased by 167%, respectively, compared to pTRV-GSTU43 plants not receiving ALA.

Under normal condition, pTRV-GSTU43 plants compared to pTRV plants had much less CAT and GR activity, and ALA application slightly restored these activities (Fig. 7). Under low temperature, pTRV-GSTU43 plants compared to pTRV plants had greater MDHAR and DHAR activity, and more ascorbate [measured as AsA and dehydroascorbate (DHA), combined], more glutathione [measured as GSH and glutathion disulfide (GSSG) combined], and slightly lower SOD, CAT, APX and GR activities, and slightly lower ratio of GSH/ GSSG (Figs. 7 and 8). When the low temperature stressed pTRV-GSTU43 plants were supplied exogenous ALA, there was a significant increase in all these antioxidase activities and antioxidant contents, compared to the same plants without ALA treatment.

Fig. 7
figure 7

Effects of exogenous ALA on antioxidase activities in partial GSTU43-silenced plants under low temperature. The VIGS plants leaves were treated with distilled water or 25 mg·L− 1 ALA, then exposed to normal condition (22 °C/20 °C, day/ night) or low temperature (15 °C/8 °C, day/ night) 12 h later. After 24 h of low temperature, these enzymes activities were measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). SOD, superoxide dismutase; CAT, catalase; APX, ascorbate peroxidase; MDHAR, monodehydroascorbate reductase; DHAR, dehydroascorbate reductase; GR, glutathione reductase

Fig. 8
figure 8

Effects of exogenous ALA on the glutathione and ascorbate content in partial GSTU43-silenced plants under low temperature. The VIGS plants leaves were treated with distilled water or 25 mg·L− 1 ALA, then exposed to normal condition (22 °C/20 °C, day/ night) or low temperature (15 °C/8 °C, day/ night) 12 h later. After 24 h of low temperature, the glutathione and ascorbate were measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). GSH, glutathione; GSSG, glutathione disulfide; AsA, ascorbate; DHA, dehydroascorbate

Discussion

Plants live in a changeable environment, which requires them to cope with a variety of environmental stress [58]. Tomatoes are a warm weather crop, and during production in some climates, they may be exposed to low temperature in winter and early spring. This can negatively affect their growth and development [59]. Alleviating the plant cold tolerance in different periods via plant growth regulators is a feasible approach. For example, GABA improved cold tolerance of tea plants by inducing amino biosynthesis, and carbon and nitrogen metabolism [60]. Interestingly, recent research showed that melatonin application at grain filling in maternal plants could improve the wheat progeny seedling chilling tolerance by regulating the redox homeostasis and photosynthesis [61]. This study of the low temperature stress response of tomatoes was prompted in part by preliminary results that exogenous ALA improved the tolerance of tomatoes to low temperature by regulating GSH and AsA pools [12]. In addition, many studies have demonstrated that exogenous ALA enhances chlorophyll content of crops exposed to low temperature [6, 10, 62].

Previous studies showed that exogenous ALA promoted the content of chlorophyll precursors in Arabidopsis [63] and Kentucky bluegrass [64]. We observed this promoting effect of ALA in tomato, also, as shown in Fig. 2 for plants in normal temperature.

It has also been noted that when plants were exposed to stress, firstly, the membranes of stressed cells may be damaged by peroxides. And then, the free porphyrinogens leaked into the cytosol from the damaged membranes and were oxidized to the lipophilic and phytotoxic protoporphyrin, which may cause more serious oxidative damage [25, 29]. In addition to the damage of binding protein and key enzymes in chlorophyll synthesis which affected the chlorophyll synthesis [65], this may serve as a mechanism for the plants to protect themselves against the damaging effect of protoporphyrin. We suggest that this self-preservation mechanism may account for our observation that UROIII was not converted to Proto IX in low temperature-stressed plants, leading not only to reduce Proto IX, but to lower levels of ALA, Mg-Proto-IX, Pchl, and chlorophyll than in the plants at normal temperature (Figs. 1 and 2).

Application of ALA alleviated the effects of low temperature on chlorophyll synthesis, accompanied by elevation of the porphyrin level. It may be that the increased amount of porphyrin in the ALA-treated plants regulated nuclear gene expression, operating in signaling [66], which then enhances plant antioxidant capacity [67], and reduces membrane lipid peroxidation of the tomato under low temperature [12]. This would permit coordinated chlorophyll synthesis (Figs. 1 and 2). Based on our results with chlorophyll synthesis related genes expression, it may be that the ALA-mediated effects on chlorophyll biosynthesis are regulated at the translation or post-translational levels, but not at the transcriptional levels (Fig. 3) [55], which still needed further researches. Similar results were also reported for ALA-regulated chlorophyll synthesis in oilseed rape [8] and Arabidopsis [54]. Redox homeostasis is important for coordinated chlorophyll synthesis [54]. Studies have shown that GSTs regulate plant redox balance by improving its antioxidant and avoiding autoxidation during stress via conjugation of leaked porphyrinogens in the cytosol [19, 25, 68].

In this study, ALA treatment up-regulated the GSTU43 gene and protein expression and GST activity (Fig. 4, Additional file 2: Figure S1). Inhibition of endogenesis ALA via GAB did not weaken the GSTU43 gene and protein expression, and GST activity, on the contrary, illustrated a maximum value under both temperature. However, GAB plus ALA treatment declined these trends. This said, exogenous ALA triggered GST activity may be mainly related to the hormones signals or transcription factor, such as ERF and MYB [19], induced by exogenous ALA, but not completely dependent on endogenesis ALA. In other words, the mechanism by which the exogenous ALA activated GSTU43 transcription and GST activity was different from that of the endogenous ALA. However, GAB, which may be as a harmful chemical inducer [19], had other effects than reducing the endogenous ALA level, and these other effects override the impact of the reduced ALA level on the expression of GSTU43 and GST activity. Simultaneously, GAB stimulated high GSTU43 transcript, and then provoked the GSTU43 protein expression and GST activity to cope with its own damage effects. Still, this was an interesting and confusing result, which needs further research.

Although low temperature alone induced GST activity, simultaneously decreased the activities of CAT and GR, and the ratio of reduced GSH, which eventually leads to the imbalance of redox and membrane lipid peroxidation (Figs. 5, 6, 7, and 8). The damaged cell membrane may influence the proteases which bind to the thylakoid membrane and catalyze the porphyrin synthesis. And porphyrins may partly leak from the chloroplasts [25], leading to a high free porphyrin level which triggered autooxidation and then further caused serious membrane damage at the same time (Fig. 5), and reduced plant growth (Additional file 3: Figure S2b and c). Exogenous ALA significantly increased the activity of GST, which may cooperate with AsA-GSH cycle to regulate the redox homeostasis, and also reduced membrane lipid peroxidation damage by binding the over-accumulation and extravasation of porphyrins [25]. This may provide the redox homeostasis for chlorophyll synthesis [54].

Silencing of GSTU43 caused MDA accumulation, increased REC, and decreased the Fv/Fm. Exogenous ALA treatment reversed these effects in low temperature (Fig. 5). We considered that GSTU43 participated in removal of ROS that accumulated during low temperature stress of these plants.

In plants, O2 is rapidly converted into H2O2 via SOD [69], which is, in turn, converted to H2O or O2 by an AsA- and/or a GSH-regenerating cycle, and/or by CAT [70]. In present study, in low temperature, GSTU43 expression and GST activity of pTRV-GSTU34 plants compared to pTRV plants significantly decreased (Fig. 6), while the activities of SOD, CAT, APX, and GR were slightly decreased (Fig. 7). Apparently, low temperature stress caused ROS accumulation and membrane injury in pTRV-GSTU43 plants, mainly due to the inhibition of GST activity, although reduced activities of SOD, CAT, APX, and GR may have also contributed.

The observed high levels of AsA + DHA in low temperature-stressed pTRV-GSTU43 plants, compared with low temperature-stressed pTRV plants may have been due to the elevated activities of MDHAR and DHAR, which could reduce the DHA to AsA with the assistant of GSH, and ultimately caused the slight decline in the ratio of GSH/GSSG in pTRV-GSTU43 plants (Figs. 7 and 8). pTRV-GSTU43 plants plus exogenous ALA caused a dramatic enhancement of these enzyme activities, and increased the levels of GSH + GSSG and AsA + DHA, and the ratios of AsA/DHA and GSH/GSSG, compared to pTRV-GSTU43 plants under low temperature (Figs. 6, 7, and 8). We suggest that ALA alleviated the oxidative stress in pTRV-GSTU43 plants primarily through GST activity, with the cooperation of the AsA-GSH cycle, effecting redox balance for coordinated chlorophyll synthesis [54].

Conclusions

Low temperature disturbed the redox balance, and damaged the integrity and stability of the membrane, which may eventually affected the chlorophyll synthesis, and reduced the chlorophyll content. Exogenous ALA increased GST protein expression and enzyme activity, encoded by GSTU43, and appeared to play a central role in protecting the tomato plant from low temperature-induced oxidative stress. It may operate with the assistance of the AsA- and/or a GSH-regenerating cycle, and actively regulated the plant redox homeostasis. This latter effect may, reduce the degree of membrane lipid peroxidation, which was essential for the coordinated synthesis of chlorophyll. Future studies may reveal the pathway how ALA induced GST outburst, which is crucial for increasing the plant’s tolerance of oxidation stress and maintain a stable chlorophyll synthesis under low temperature.

Availability of data and materials

The datasets analyzed during the current study are available from the corresponding author on reasonable request.

Abbreviations

ALA:

5- aminolevulinic acid

APX:

Ascorbate peroxidase

AsA:

Ascorbate

CAT:

Catalase

DHAR:

Dehydroascorbate reductase

Fv/Fm:

Maximal quantum yield of PSII photochemistry

GAB:

Gabaculine

GR:

Glutathione reductase

GSH:

Glutathione

GST:

Glutathione S-transferase

H2O2 :

Hydrogen peroxide

MDA:

Malondialdehyde

MDHAR:

Monodehydroascorbate reductase

Mg-proto IX:

Mg-protoporphyrin IX

PBG:

Porphobilinogen

Pchl:

Protochlorophyll

Proto IX:

Protoporphyrin IX

REC:

Relative electrical conductivity

SOD:

Superoxide dismutase

UROIII:

uroporphyrinogen III

References

  1. Browse J, Xin Z. Temperature sensing and cold acclimation. Curr Opin Plant Biol. 2001;4(3):241–6.

    Article  CAS  Google Scholar 

  2. Nahar K, Hasanuzzaman M, Alam MM, Fujita M. Exogenous spermidine alleviates low temperature injury in mung bean (Vigna radiata L.) seedlings by modulating ascorbate-glutathione and glyoxalase pathway. Int J Mol Sci. 2015;16(12):30117–32.

    Article  CAS  Google Scholar 

  3. Akram NA, Ashraf M. Regulation in plant stress tolerance by a potential plant growth regulator, 5-aminolevulinic acid. J Plant Growth Regul. 2013;32(3):663–79.

    Article  CAS  Google Scholar 

  4. An YY, Feng XX, Liu LB, Xiong LJ, Wang LJ. ALA-induced flavonols accumulation in guard cells is involved in scavenging H2O2 and inhibiting stomatal closure in Arabidopsis cotyledons. Front Plant Sci. 2016;7:1713.

    PubMed  PubMed Central  Google Scholar 

  5. Feng XX, An YY, Zheng J, Sun M, Wang LJ. Proteomics and SSH analyses of ALA-promoted fruit coloration and evidence for the involvement of a MADS-box gene, MdMADS1. Front Plant Sci. 2016;7:1615.

    PubMed  PubMed Central  Google Scholar 

  6. Korkmaz A, Korkmaz Y, Demirkıran AR. Enhancing chilling stress tolerance of pepper seedlings by exogenous application of 5-aminolevulinic acid. Environ Exp Bot. 2010;67(3):495–501.

    Article  CAS  Google Scholar 

  7. Ali B, Xu X, Gill RA, Yang S, Ali S, Tahir M, Zhou WJ. Promotive role of 5-aminolevulinic acid on mineral nutrients and antioxidative defense system under lead toxicity in Brassica napus. Ind Crop Prod. 2014;52:617–26.

    Article  CAS  Google Scholar 

  8. Liu D, Kong DD, Fu XK, Ali B, Xu L, Zhou WJ. Influence of exogenous 5-aminolevulinic acid on chlorophyll synthesis and related gene expression in oilseed rape de-etiolated cotyledons under water-deficit stress. Photosynthetica. 2016;54(3):468–74.

    Article  CAS  Google Scholar 

  9. Li DM, Zhang J, Sun WJ, Li Q, Dai AH, Bai JG. 5-aminolevulinic acid pretreatment mitigates drought stress of cucumber leaves through altering antioxidant enzyme activity. Sci Hortic-Amsterdam. 2011;130(4):820–8.

    Article  CAS  Google Scholar 

  10. Guo XQ, Li YS, Yu XC. Promotive effects of 5-aminolevulinic acid on photosynthesis and chlorophyll fluorescence of tomato seedlings under suboptimal low temperature and suboptimal photon flux density stress- short communication. Hortscience. 2012;39(2):97–9.

    Google Scholar 

  11. Sun XE, Feng XX, Li C, Zhang ZP, Wang LJ. Study on salt tolerance with YHem1 transgenic canola (Brassica napus). Physiol Plant. 2015;154(2):223–42.

    Article  CAS  Google Scholar 

  12. Liu T, Hu XH, Zhang J, Zhang JH, Du QJ, Li JM. H2O2 mediates ALA-induced glutathione and ascorbate accumulation in the perception and resistance to oxidative stress in Solanum lycopersicum at low temperatures. BMC Plant Biol. 2018;18:34.

    Article  Google Scholar 

  13. Foyer CH, Noctor G. Ascorbate and glutathione: the heart of the redox hub. Plant Physiol. 2011;155(1):2–18.

    Article  CAS  Google Scholar 

  14. Ball L, Accotto GP, Bechtold U, Creissen G, Funck D, Jimenez A, Kular B, Leyland N, Mejia-Carranza J, Reynolds H, Karpinski S, Mullineaux PM. Evidence for a direct link between glutathione biosynthesis and stress defense gene expression in Arabidopsis. Plant Cell. 2004;16(9):2448–62.

    Article  CAS  Google Scholar 

  15. Li H, He J, Yang XZ, Li X, Luo D, Wei CH, Ma JX, Zhang Y, Yang JQ, Zhang X. Glutathione-dependent induction of local and systemic defense against oxidative stress by exogenous melatonin in cucumber(Cucumis sativus L.). J Pineal Res. 2016;60:206–16.

    Article  CAS  Google Scholar 

  16. Jiang YP, Cheng F, Zhou YH, Xia XJ, Mao WH, Shi K, Chen ZX, Yu JQ. Cellular glutathione redox homeostasis plays an important role in the brassinosteroid-induced increase in CO2 assimilation in Cucumis sativus. New Phytol. 2012;194(4):932–43.

    Article  CAS  Google Scholar 

  17. Edwards R, Dixon DP, Walbot V. Plant glutathione S-transferases: enzymes with multiple functions in sickness and in health. Trends Plant Sci. 2000;5(5):193–8.

    Article  CAS  Google Scholar 

  18. Dixon DP, Cummins I, Cole DJ, Edwards R. Glutathione-mediated glutathione-dependent in the detoxification compounds. Detoxification systems in plants. Curr Opin Plant Biol. 1998;1(3):258–66.

    Article  CAS  Google Scholar 

  19. Nianiou-Obeidat I, Madesis P, Kissoudis C, Voulgari G, Chronopoulou E, Tsaftaris A, Labrou NE. Plant glutathione transferase-mediated stress tolerance: functions and biotechnological applications. Plant Cell Rep. 2017;36(6):791–805.

    Article  CAS  Google Scholar 

  20. Csiszar J, Horvath E, Vary Z, Galle A, Bela K, Brunner S, Tari I. Glutathione transferase supergene family in tomato: salt stress-regulated expression of representative genes from distinct GST classes in plants primed with salicylic acid. Plant Physiol Biochem. 2014;78:15–26.

    Article  CAS  Google Scholar 

  21. Sun W, Xu XN, Zhu HS, Liu AH, Liu LL, Li JM, Hua XJ. Comparative transcriptomic profiling of a salt-tolerant wild tomato species and a salt-sensitive tomato cultivar. Plant Cell Physiol. 2010;51(6):997–1006.

    Article  CAS  Google Scholar 

  22. George S, Venkataraman G, Parida A. A chloroplast-localized and auxin-induced glutathione S-transferase from phreatophyte Prosopis juliflora confer drought tolerance on tobacco. J Plant Physiol. 2010;167(4):311–8.

    Article  CAS  Google Scholar 

  23. Roxas VP, Lodhi SA, Garrett DK, Mahan JR, Allen RD. Stress tolerance in transgenic tobacco seedlings that overexpress glutathione S- transferase/glutathione peroxidase. Plant Cell Physiol. 2000;41(11):1229–34.

    Article  CAS  Google Scholar 

  24. Takesawa T, Ito M, Kanzaki H, Kameya N, Nakamura I. Over-expression of ζ glutathione S-transferase in transgenic rice enhances germination and growth at low temperature. Mol Breeding. 2002;9:93–101.

    Article  CAS  Google Scholar 

  25. Dixon DP, Lapthorn A, Madesis P, Mudd EA, Day A, Edwards R. Binding and glutathione conjugation of porphyrinogens by plant glutathione transferases. J Biol Chem. 2008;283(29):20268–76.

    Article  CAS  Google Scholar 

  26. Chen CY, Ho SS, Kuo TY, Hsieh HL, Cheng YS. Structural basis of jasmonate-amido synthetase FIN219 in complex with glutathione S-transferase FIP1 during the JA signal regulation. Proc Natl Acad Sci U S A. 2017;114(10):1815–24.

    Article  Google Scholar 

  27. Dixon DP, Skipsey M, Edwards R. Roles for glutathione transferases in plant secondary metabolism. Phytochemistry. 2010;71(4):338–50.

    Article  CAS  Google Scholar 

  28. Wang P, Grimm B. Organization of chlorophyll biosynthesis and insertion of chlorophyll into the chlorophyll-binding proteins in chloroplasts. Photosynth Res. 2015;126(2–3):189–202.

    Article  CAS  Google Scholar 

  29. Lederer B, Böger P. Binding and protection of porphyrins by glutathione S-transferases of Zea mays L. BBA. 2003;1621(2):226–33.

    CAS  PubMed  Google Scholar 

  30. Al-Ghamdi AA, Elansary HO. Synergetic effects of 5-aminolevulinic acid and Ascophyllum nodosum seaweed extracts on Asparagus phenolics and stress related genes under saline irrigation. Plant Physiol Biochem. 2018;129:273–84.

    Article  CAS  Google Scholar 

  31. Niu KJ, Ma X, Liang GL, Ma HL, Jia ZF, Liu WH, Yu QQ. 5-Aminolevulinic acid modulates antioxidant defense systems and mitigates drought-induced damage in Kentucky bluegrass seedlings. Protoplasma. 2017;254(6):2083–94.

    Article  CAS  Google Scholar 

  32. Sheteiwy M, Shen H, Xu JG, Guan YJ, Song WJ, Hu J. Seed polyamines metabolism induced by seed priming with spermidine and 5-aminolevulinic acid for chilling tolerance improvement in rice (Oryza sativa L.) seedlings. Environ Exp Bot. 2017;137:58–72.

    Article  CAS  Google Scholar 

  33. Xiong JL, Wang HC, Tan XY, Zhang CL, Naeem MS. 5-aminolevulinic acid improves salt tolerance mediated by regulation of tetrapyrrole and proline metabolism in Brassica napus L. seedlings under NaCl stress. Plant Physiol Biochem. 2018;124:88–99.

    Article  CAS  Google Scholar 

  34. Liu T, Xu JJ, Li JM, Hu XH. NO is involved in JA- and H2O2-mediated ALA-induced oxidative stress tolerance at low temperatures in tomato. Environ Exp Bot. 2019;161:334–43.

    Article  CAS  Google Scholar 

  35. Czarnecki O, Gläßer C, Chen JG, Mayer KFX, Grimm B. Evidence for a contribution of ALA synthesis to plastid-to-nucleus signaling. Front Plant Sci. 2012;3:00236.

    Article  CAS  Google Scholar 

  36. Demko V, Pavlovič A, Hudák J. Gabaculine alters plastid development and differentially affects abundance of plastid-encoded DPOR and nuclear-encoded GluTR and FLU-like proteins in spruce cotyledons. J Plant Physiol. 2010;167(9):693–700.

    Article  CAS  Google Scholar 

  37. Cheng F, Yin LL, Zhou J, Xia XJ, Shi K, Yu JQ, Zhou YH, Foyer CH. Interactions between 2-Cys peroxiredoxins and ascorbate in autophagosome formation during the heat stress response in Solanum lycopersicum. J Exp Bot. 2016;67(6):1919–33.

    Article  CAS  Google Scholar 

  38. Ekengren SK, Lui Y, Schiff M, Dinesh-Kumar SP, Martin GB. Two MAPK cascades, NPR1, and TGA transcription factors play a role in pro-mediated disease resistance in tomato. Plant J. 2003;36(6):905–17.

    Article  CAS  Google Scholar 

  39. Strain HH, Svec WA. Extraction, separation, estimation and isolation of the chlorophylls. In: Vernon LP, Seeley GR, editors. The chlorophylls. New York: Academic Press; 1966. p. 21–66.

    Chapter  Google Scholar 

  40. Morton RA. Biochemical spectroscopy: a. Hilger; London; Bristol; 1975. p. 1.

    Google Scholar 

  41. Bogorad L. Methods in Enzymology, vol. 5. San Diego, New York, Berkeley, Boston, London, Sydney, Tokyo: Toronto Academic Press; 1962. p. 885–95.

    Book  Google Scholar 

  42. Hodgins R, Van Huystee R. Rapid simultaneous estimation of protoporphyrin and mg–porphyrins in higher plants. J Plant Physiol. 1986;125:311–23.

    Article  CAS  Google Scholar 

  43. Li JM, Hu LP, Zhang L, Pan XB, Hu XH. Exogenous spermidine is enhancing tomato tolerance to salinity-alkalinity stress by regulating chloroplast antioxidant system and chlorophyll metabolism. BMC Plant Biol. 2015;15:303.

    Article  CAS  Google Scholar 

  44. Willekens H, Chamnongpol S, Davey M, Schraudner M, Langebartels C, Montagu MV, Inzé D, Camp WV. Catalase is a sink for H2O2 and is indispensable for stress defence in C3 plants. EMBO J. 1997;16(16):4806–16.

    Article  CAS  Google Scholar 

  45. Hodges DM, DeLong JM, Forney CF, Prange RK. Improving the thiobarbituric acid-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other inerfering compounds. Planta. 1999;207:604–11.

    Article  CAS  Google Scholar 

  46. Zhou WJ, Leul M. Uniconazole-induced alleviation of freezing injury in relation to changes in hormonal balance, enzyme activities and lipid peroxidation in winter rape. Plant Growth Regul. 1998;26:41–7.

    Article  CAS  Google Scholar 

  47. Perez-Bueno ML, Pineda M, Diaz-Casado E, Baron M. Spatial and temporal dynamics of primary and secondary metabolism in phaseolus vulgaris challenged by pseudomonas syringae. Physiol Plant. 2015;153(1):161–74.

    Article  CAS  Google Scholar 

  48. Giannopolitis CN, Ries SK. Superoxide dismutases I. Occurrence in higher plants. Plant Physiol. 1977;59:309–14.

    Article  CAS  Google Scholar 

  49. Noctor G, Mhamdi A, Foyer CH. Oxidative stress and antioxidative systems: recipes for successful data collection and interpretation. Plant Cell Environ. 2016;39(5):1140–60.

    Article  CAS  Google Scholar 

  50. Vandesompele J, Preter KD, Pattyn F, Poppe B, VanRoy N, Paepe AD, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):0034.

    Article  Google Scholar 

  51. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-C T method. Methods. 2001;25(4):402–8.

    Article  CAS  Google Scholar 

  52. Zhou J, Xu XC, Cao JJ, Yin LL, Xia XJ, Shi K, Zhou YH, Yu JQ. Heat shock factor HsfA1a is essential for R gene-mediated nematode resistance and triggers H2O2 production. Plant Physiol. 2018;176(3):2456–71.

    Article  CAS  Google Scholar 

  53. Ali B, Wang B, Ali S, Ghani MA, Hayat MT, Yang C, Xu L, Zhou WJ. 5-aminolevulinic acid ameliorates the growth, photosynthetic gas exchange capacity, and ultrastructural changes under cadmium stress in Brassica napus L. J Plant Growth Regul. 2013;32(3):604–14.

    Article  CAS  Google Scholar 

  54. Da QG, Wang P, Wang ML, Sun T, Jin HL, Liu B, Grimm B, Wang HB. Thioredoxin and NADPH-dependent thioredoxin reductase C regulation of tetrapyrrole biosynthesis. Plant Physiol. 2017;175(2):652–66.

    CAS  PubMed  PubMed Central  Google Scholar 

  55. Apitz J, Nishimura K, Schmied J, Wolf A, Hedtke B, van Wijk KJ, Grimm B. Posttranslational control of ALA synthesis includes GluTR degradation by Clp protease and stabilization by GluTR-binding protein. Plant Physiol. 2016;170(4):2040–51.

    Article  CAS  Google Scholar 

  56. Dietz KJ, Mittler R, Noctor G. Recent progress in understanding the role of reactive oxygen species in plant cell signaling. Plant Physiol. 2016;171(3):1535–9.

    Article  CAS  Google Scholar 

  57. Foyer CH, Noctor G. Stress-triggered redox signalling: what's in pROSpect? Plant Cell Environ. 2016;39(5):951–64.

    Article  CAS  Google Scholar 

  58. Zhu JK. Abiotic stress signaling and responses in plants. Cell. 2016;167(2):313–24.

    Article  CAS  Google Scholar 

  59. Xia XJ, Fang PP, Guo X, Qian XJ, Zhou J, Shi K, Zhou YH, Yu JQ. Brassinosteroid-mediated apoplastic H2O2-glutaredoxin 12/14 cascade regulates antioxidant capacity in response to chilling in tomato. Plant Cell Environ. 2017;41(5):1052–64.

    Article  Google Scholar 

  60. Zhu XJ, Liao JR, Xia XL, Xiong F, Yue L, Shen JZ, Wen B, Ma YC, Wang YH, Fang WP. Physiological and iTRAQ-based proteomic analyses reveal the function of exogenous γ-aminobutyric acid (GABA) in improving tea plant (Camellia sinensis L.) tolerance at cold temperature. BMC Plant Biol. 2019;19:43.

    Article  Google Scholar 

  61. Li XN, Brestic M, Tan DX, Zivcak M, Zhu XC, Liu SQ, Song FB, Reiter RJ, Liu FL. Melatonin alleviates low PS I-limited carbon assimilation under elevated CO2 and enhances the cold tolerance of offspring in chlorophyll b-deficient mutant wheat. J Pineal Res. 2018;64:e12453.

    Article  Google Scholar 

  62. Wang LJ, Jiang WB, Huang BJ. Promotion of 5-aminolevulinic acid on photosynthesis of melon (Cucumis melo) seedlings under low light and chilling stress conditions. Physiol Plant. 2004;121:258–64.

    Article  CAS  Google Scholar 

  63. Mochizuki N, Tanaka R, Tanaka A, Masuda T, Nagatani A. The steady-state level of mg-protoporphyrin IX is not a determinant of plastid-to-nucleus signaling in Arabidopsis. Proc Natl Acad Sci U S A. 2008;105(39):15184–9.

    Article  CAS  Google Scholar 

  64. Niu KJ, Ma HL. The positive effects of exogenous 5-aminolevulinic acid on the chlorophyll biosynthesis, photosystem and Calvin cycle of Kentucky bluegrass seedlings in response to osmotic stress. Environ Exp Bot. 2018;155:260–71.

    Article  CAS  Google Scholar 

  65. Stenbaek A, Jensen PE. Redox regulation of chlorophyll biosynthesis. Phytochemistry. 2010;71(8–9):853–9.

    Article  CAS  Google Scholar 

  66. Larkin RM. Tetrapyrrole signaling in plants. Front Plant Sci. 2016;7:1586.

    Article  Google Scholar 

  67. Zhang ZW, Yuan S, Xu F, Yang H, Chen YE, Yuan M, Xu MY, Xue LW, Xu XC, Lin HH. Mg-protoporphyrin, haem and sugar signals double cellular total RNA against herbicide and high-light-derived oxidative stress. Plant Cell Environ. 2011;34(6):1031–42.

    Article  CAS  Google Scholar 

  68. Dixon DP, Steel PG, Edwards R. Roles for glutathione transferases in antioxidant recycling. Plant Signal Behav. 2011;6(8):1223–7.

    Article  CAS  Google Scholar 

  69. Willems P, Mhamdi A, Stael S, Storme V, Kerchev P, Noctor G, Gevaert K, Van Breusegem F. The ROS wheel: refining ROS transcriptional footprints. Plant Physiol. 2016;171(3):1720–33.

    Article  Google Scholar 

  70. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002;7(9):405–10.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank Pro. Qingmei Guan and Dr. Dehui Zhang for their assistance of western blotting experiment; and thank Pro. Zhen Li, Hao Li, and Dr. Fang Ma, Jianhua Jia and Hao Sun for their assistance of VIGS experiment (College of Horticulture, Northwest A & F University).

Funding

This work was supported by grants from the Key Research and Development Program of Shaanxi Province, China (2018TSCXL-NY-05-01), the China Agriculture Research System (CARS-23-C-05) and Northwest A & F University Experimental Demonstration Station (base) Science and Technology Innovation and Achievement Transformation Project (TGZX2019-23). The funders had no role in the experiment design, data analysis, decision to publish, or preparation of the manuscript.

Author information

Authors and Affiliations

Authors

Contributions

TL, XH and JL designed the experiments and wrote the manuscript. TL, QD, SL, JY, XL, JX, and PC performed the experiments. TL and XH analyzed the data. All authors have read and approved the final version of the manuscript.

Corresponding author

Correspondence to Xiaohui Hu.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Additional files

Additional file 1:

Table S1. Gene-specific primers designed for qRT-PCR. (DOCX 16 kb)

Additional file 2:

Figure S1. ALA induced changes of glutathione S-transferase (GSTU43) gene using RNA-seq in tomato leaves under low temperature. The tomato leaves treated with distilled water or 25 mg·L− 1 ALA then exposed to normal condition (control and ALA) or low temperature (LT and LTA) 12 h later. After 24 h low temperatures, the FPKM of GSTU43 gene we measured. Data are expressed as the mean ± standard error of three independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05). (JPG 886 kb)

Additional file 3:

Figure S2. Characterization of tomato pTRV-GSTU43 plants and ALA induced changes of phenotypes and growth in GSTU43-silenced plants under low temperature. (a) Expression of GSTU43 gene expression in pTRV and pTRV-GSTU43 plants. (b) The dry weight of plants. (c) The phenotypes of plants. The GSTU43 gene expression was measured at 35 d after infection. The gene transcription level in pTRV plants was normalized as 1. And then VIGS plants leaves were treated with distilled water or 25 mg·L− 1 ALA, subsequently exposed to normal condition (22 °C/20 °C, day/ night) or low temperature (15 °C/8 °C, day/ night) 12 h later. After 6 d of low temperature, the plants dry weight were measured and taken photos. Data are expressed as the mean ± standard error of seven independent biological replicates. The experiments were repeated for three times. Different letters above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.05), while ‘**’ above the bars indicate a significant difference determined by one-way ANOVA with Tukey’s test (P < 0.01). (JPG 3827 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Liu, T., Du, Q., Li, S. et al. GSTU43 gene involved in ALA-regulated redox homeostasis, to maintain coordinated chlorophyll synthesis of tomato at low temperature. BMC Plant Biol 19, 323 (2019). https://doi.org/10.1186/s12870-019-1929-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12870-019-1929-1

Keywords