Plant materials
Fortune and Murcott mandarins (Citrus reticulata Blanco), as well as nine Fortune × Murcott hybrids were used in this study. Fortune produces abundant valencene, whereas valencene was undetectable in Murcott. The nine hybrids were randomly selected from a F1 segregated population for genetic mapping [11], including FoMu-001, FoMu-003, FoMu-004, FoMu-005, FoMu-007, FoMu-012, FoMu-083, FoMu-097, FoMu-114. Fruits with uniform size and color, and free of peel defects from Fortune, Murcott and F1 hybrids were harvested randomly in their estimated commercial maturity in 2012 and 2013. The production of valencene is maximized when the fruit are mature. All samples were stored in − 80 °C for future experiments.
Volatile compound identification
Sample preparation for volatile and aroma identification used the same methods as previously described [10]. Briefly, 3 mL juice was mixed with the same volume of saturated sodium chloride solution (359 g/L), and an internal standard 3-hexanone with a final concentration of 10 μM. The mixture was prepared in a 20 ml glass vial and sealed with a silicone/PTFE septum. The vials were stored at − 20 °C until analyzed. For analysis, juice samples were incubated for 30 min at 40 °C, and a 2.0 cm solid phase microextraction (SPME) fiber (50/30 μm DVB/Carboxen/PDMS; Supelco, Bellefonte, PA) was used to extract the volatiles. Volatiles were analyzed by a GCMS (Model 6890/5973 N, Agilent, Santa Clara, CA) with a DB5 column (60-m length, 0.25-mm i.d., 1.00-μm film thickness). The program settings were according to the report [10]. Volatile compounds were identified by comparing their mass spectra with the authorized standard chemicals, the NIST mass spectral database, and published retention indices. The amount of each aroma volatile was expressed as relative content (aroma volatile peak area over internal standard peak area).
RNA extraction and QRT-PCR
Total RNA was extracted from the fruit peel of each sample using the PureLink plant RNA reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. DNA was removed by the Turbo DNA-free Kit (Ambion, Austin, TX). The Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technology) was used for QRT-PCR. It was carried out in the Agilent Mx3005P System (Agilent Technology) using glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) as a reference gene. The specific primers for QRT-PCR of Cstps1 were designed according to the report of Sharon-Asa et al. (2003) [5]. The results of relative Cstps1 expression were expressed as normalized mean values and standard error.
Isolation of Cstps1 cDNA and promoters
Total RNA of Fortune and Murcott mandarin fruit were used to synthesize cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The primers (Tps1-F: 5′-ATGTCGTCTGGAGAAACATTTC-3′; Tps1-R: 5′-TCAAAATGGAACGTGGTCTCCT-3′) for the amplification of Cstps1 cDNA were designed based on the sequence of Citrus sinensis TPS1 from NCBI (gi:572152984). PCR products were cloned into pGEM-T vector (Promega Corporation) for sequencing. Genomic DNA was extracted with DNeasy Plant Kits (Qiagen, Valencia, CA) from the leaves of Fortune and Murcott mandarin. Genomic region of Cstps1 gene was amplified by PCR using the same primers for the isolation of cDNA, and PCR products were cloned into pGEM-T vector for sequencing. The 5′ upstream region of Cstps1 was isolated using GenomeWalker Universal Kit (Clontech Laboratories, Mountain View, CA). Genomic DNA was digested by the four restriction enzymes (DraI, EcoRV, PvuII and StuI) to build blunt end GenomeWalker libraries. Using the libraries as template, primary and nested PCRs were performed using the GenomeWalker adaptor primers (AP1: 5′-GTAATACGACTCACTATAGGGC-3′; AP2: 5′-ACTATAGGGCACGCGTGGT-3′) provided in the kit and gene-specific primers (GSP1: 5′-GGGATGTTTGGGTTCATCTTTAC-3′; GSP2: 5′-CAGAAGCACCTTTGAGGAAATG-3′) designed according to the obtained sequences of Cstps1 gene. Nested PCR products were checked by electrophoresis in 1.5% (w/v) agarose gel, and the products with reasonable size were cloned into the pGEM-T vector for sequencing. For all times of sequencing, at least five clones were randomly selected and sequenced by the Interdisciplinary Center for Biotechnology sequencing facility of the University of Florida. The software SeqMan in DNAStar was used to align and analyze the sequences. The inconsistent single nucleotide sites with ratio of base type above or equal to 1/3 were replaced with corresponding degenerate nucleotide codes, otherwise, they were considered as sequencing errors. The program ClustalW2 in European Bioinformatics Institute were used to process the output sequences and construct alignment between different varieties.
Plasmid construction
Using a pair of primers, FMP1-SbfI (5′- AGGTCCTGCAGGATCACGAAATTTATTTTTGAATTCCG-3′) and FMP2-BglII (5′- AGGTAGATCTTTTGTGTCAGACAAACGGGTGCTGC-3′), the Cstps1 promoter (P) was amplified from genomic DNA of Fortune and Murcott. After sequencing, the PCR products were digested with SbfI and BglII, and inserted into SbfI-BamHI-treated p1380-35S-GUSin to form binary vectors p1380-FortP-GUSin, p1380-MurcP-GUSin (Fig. 6b). One part of the Cstps1 promoter of Murcott was amplified using primers FMP1-SbfI and Murc(+ 12) P2 (5′-phosphorylated-CTTTTTGGCCTATTTATAACTTATGGTTTT-3′). After sequencing, the PCR products were digested with SbfI. Another part was amplified using primers Murc(+ 12) P1 (5′-phosphorylated- AAAAAGAAAAAAAAATTGACACAATTTTGAGAA -3′) and FMP2-BglII. After sequencing, the PCR products were digested with BglII. Through three-way ligation, SbfI-digested part of the Cstps1 promoter and BglII-treated other part were inserted into SbfI-BamHI-cut p1380-35S-GUSin to form p1380-MurcP(+ 12)-GUSin (Fig. 6a). Binary vector p1380-AtHSP70BP-GUSin was used as negative control, which was developed previously [11]. It should be noted that all binary vectors harbor right border (RB) and left border (RB), which delimit transfer DNA (T-DNA). Agrobacterium strains transfer T-DNA to plant cells. In addition, the intron-containing GUS (GUSin) was employed here, since the intron is only spliced in plant cells, resulting in GUS enzymatic activity [20]. By the freeze-thaw method, the binary vectors were introduced into A. tumefaciens strain EHA105, respectively. Recombinant Agrobacterium cells were cultivated for Xcc-facilitated agroinfiltration.
Xcc-facilitated agroinfiltration in Valencia sweet orange
Valencia plants, grown in a greenhouse at temperatures ranging from 25 to 30 °C, were pruned to produce uniform shoots before Xcc-facilitated agroinfiltration. Xcc-facilitated agroinfiltration in citrus leaves was performed as described previously with some modifications [11]. Briefly, citrus leaves were subjected for inoculation with a culture of actively growing XccΔgumC, which was re-suspended in sterile tap water (5 × 108 CFU/ml). Thirty-six hours later, Agrobacterium cells containing p1380-FortP-GUSin, p1380-MurcP-GUSin, p1380-MurcP(+ 12)-GUSin or p1380-AtHSP70BP-GUSin, were agroinfiltrated into the same leaf area (Fig. 6b). Four days after agroinfiltration, leaves were assayed by the histochemical staining of GUS.
