Skip to main content

SOS1 gene family in mangrove (Kandelia obovata): Genome-wide identification, characterization, and expression analyses under salt and copper stress

Abstract

Background

Salt Overly Sensitive 1 (SOS1), a plasma membrane Na+/H+ exchanger, is essential for plant salt tolerance. Salt damage is a significant abiotic stress that impacts plant species globally. All living organisms require copper (Cu), a necessary micronutrient and a protein cofactor for many biological and physiological processes. High Cu concentrations, however, may result in pollution that inhibits the growth and development of plants. The function and production of mangrove ecosystems are significantly impacted by rising salinity and copper contamination.

Results

A genome-wide analysis and bioinformatics techniques were used in this study to identify 20 SOS1 genes in the genome of Kandelia obovata. Most of the SOS1 genes were found on the plasma membrane and dispersed over 11 of the 18 chromosomes. Based on phylogenetic analysis, KoSOS1s can be categorized into four groups, similar to Solanum tuberosum. Kandelia obovata's SOS1 gene family expanded due to tandem and segmental duplication. These SOS1 homologs shared similar protein structures, according to the results of the conserved motif analysis. The coding regions of 20 KoSOS1 genes consist of amino acids ranging from 466 to 1221, while the exons include amino acids ranging from 3 to 23. In addition, we found that the 2.0 kb upstream promoter region of the KoSOS1s gene contains several cis-elements associated with phytohormones and stress responses. According to the expression experiments, seven randomly chosen genes experienced up- and down-regulation of their expression levels in response to copper (CuCl2) and salt stressors.

Conclusions

For the first time, this work systematically identified SOS1 genes in Kandelia obovata. Our investigations also encompassed physicochemical properties, evolution, and expression patterns, thereby furnishing a theoretical framework for subsequent research endeavours aimed at functionally characterizing the Kandelia obovata SOS1 genes throughout the life cycle of plants.

Peer Review reports

Background

Plants are vulnerable to a range of unfavorable environmental circumstances since their life cycle is sessile [1]. Plants naturally thrive in challenging environments [2], and their natural surroundings consist of non-living and living factors that cause stress [3]. Abiotic stressors, such as excessive salinity and heavy metals, are the primary limiting factors that negatively impact plant growth and development. These stressors eventually have a detrimental effect on crop output and sustainability [4, 5]. Salinity is a major contributor to reduced crop yield, negatively impacting plant vitality [1]. A significant amount of arable land experiences increasing Na+ concentration ([Na+]), making salinity stress a significant agricultural concern [6, 7]. High levels of sodium ions (Na+) disturb the balance of ion concentrations within cells and hinder plant metabolism. As sodium (Na+) is unnecessary for plants, any excess amount of sodium ions [Na+] should be removed or stored in specific compartments to minimize the harmful effects of excessive ionic toxicity [6, 8].

Nonetheless, the productivity and function of the mangrove ecosystem are strongly impacted by rising salinity and heavy metal contamination [9]. Mangroves possess unique mechanisms to cope with the stress caused by salt exposure. These mechanisms enable them to conduct gaseous exchange, reproduction, and physiological adaptations for salt exclusion and excretion [10]. Certain mangrove species release organic chemicals at the molecular level to control salt content and maintain osmotic balance [11]. Nevertheless, the efficacy of these mechanisms that exclude and excrete salt in the presence of salt and heavy metal stress is still unknown. Gaining insight into these regulatory mechanisms during prolonged stress could enhance our understanding and aid in developing novel management solutions.

For numerous physiological processes, copper is a necessary protein cofactor and is a vital component of all living organisms [12]. Nevertheless, elevated levels of Cu can result in pollution, resulting in a decline in plant growth and hindered developmental processes [13]. As stated by Cano-Gauci and Sarkar [14], the high reactivity of Cu can lead to substantial oxidative harm in cells, impairments in germination, difficulties in flowering, and delayed growth of roots. Eukaryotic organisms have developed a mechanism to efficiently control the uptake and distribution of copper in response to both deficiencies and surpluses of this vital element [15]. Copper plays a crucial role in various physiological processes in plants, including cell wall metabolism, removal of superoxide radicals, photosynthesis, mitochondrial respiration, and detection of ethylene gas [16]. Plants with low amounts of copper have many abnormal characteristics, such as decreased water transportation, impaired growth of young leaves, and slower growth and reproductive development [17]. Shen et al. [18] reported that Kandelia Obovata species exhibited different tolerance levels to several heavy metals. It could withstand copper stress at a concentration of 400 mg/L. Hence, the experiment encompassed various concentrations of Cu solution, ranging from 0 to 400 mg/L [19].

The Salt Overly Sensitive (SOS) signaling system is crucial for plants to respond to salt stress. The composition comprises three constituents: SOS1, SOS2, and SOS3 [20, 21]. SOS1 is a transporter that moves Na+ ions out of the root and into the xylem vessel for long-distance transport [22]. The SOS1 genes were initially discovered in Arabidopsis [23, 24] and were named AtNHX1-AtNHX8. AtNHX7, also known as AtSOS1, plays a crucial role in the SOS signaling system [25]. The SOS1 protein is in the plasma membrane [26]. AtSOS1 expression is primarily seen in parenchyma along the xylem-symplast border of the root, stem, and leaf, as well as in epidermal cells at the tip of the root. This implies that this transporter is involved in controlling the long-distance movement of Na+ in plants as well as eliminating Na+ from the plant into the surrounding medium [27]. With 12 transmembrane domains in each unit's N-terminal region, SOS1 operates as a homodimer. It also has a long C-terminal region with three domains: an auto-inhibitory domain, a cyclic nucleotide-binding domain, and a cytosolic domain [20, 28]. Plant tolerance to salt is regulated by SOS proteins [20]. The accumulation of Na+ in the xylem and shoot decreased as a result of SOS1 overexpression [26].

The physiological functions of the related SOS1 genes have also been studied in cash crop plants, including Solanum tuberosum L. [20], wheat [29], tuber mustard [21], Arabidopsis [6], maize [30], and Chenopodium quinoa Willd. [31]. The GmSOS1 mutants in soybeans showed a notable buildup of Na+ in their roots, leading to an imbalance between Na+ and K+. This indicates that GmSOS1 is crucial in maintaining Na+ homeostasis and enhancing salt tolerance in soybeans [32]. The SOS pathway in maize exhibits a preserved ability to tolerate salt, and its components (ZmSOS1 and ZmCBL8) play a role in regulating Na+ and displaying natural variability in salt tolerance. This makes them valuable gene targets to breed salt-tolerant maize [33]. However, its function in Kandelia obovata has not yet been studied.

The existence of the SOS1 gene family in Kandelia obovata is not currently supported by published data. As a result, this study represents the first time that SOS1 genes have been found throughout the whole genome of Kandelia obovata. This work discovered, described, and investigated the expression levels of 20 SOS1 genes in response to CuCl2 and salt treatments. To gain more comprehensive knowledge, various bioinformatics methods were used to examine different elements of the evolutionary patterns of SOS1 genes in Kandelia obovata. Numerous features were examined in the investigation, such as subcellular localization, conserved motifs, cis-elements, phylogenetic connections, chromosomal distribution, physicochemical traits, gene structure, synteny and duplication structures, and the expression profiles of SOS1 homologs. In this study, the SOS1 family in Kandelia obovata is characterized and analyzed with an emphasis on expression. With this study, we hope to lay the theoretical groundwork for future research on how the SOS1 family in Kandelia obovata plants responds to treatments with CuCl2 and salt.

Results

Genome-wide identification and characterization of SOS1 Family Members in Kandelia obovata genome

Kandelia obovata's genome contains 20 SOS1 genes, much more than the previously reported SOS1 in Tuber mustard. The statistical results showed that the protein length ranged from 466 (KoSOS1007616) to 1221 (KoSOS1014074) amino acids; the average length was 735.8. The molecular weight of the SOS1 family ranged from 51.43 (KoSOS1007616) to 131.93 (KoSOS1014074), with an average of 80.62 kDa. The isoelectric points (pIs) of the KoSOS1 proteins varied from 5.07 (KoSOS1014074) to 9.58 (KoSOS1014977), respectively. Instability Index varying from 27.51 (KoSOS1003260) to 43.93 (KoSOS1007616). The SOS1 family's average Aliphatic Index ranged from 100.72 to 122.51, while KoSOS1013784 had the highest and KoSOS1012320 had the lowest Aliphatic Index. Grand average hydropathy index (GRAVY) values for 20 SOS1s showed a hydrophobic character, ranging from 0.089 (KoSOS1014074) to 0.673 (KoSOS1012320). Next, the Na+/H+ exchanger (NHX) domain content of the candidates was verified using the SMART program (Table 1). Determining the subcellular location of SOS1 proteins would facilitate a better understanding of the molecular function. Twenty SOS1s were most likely located in the plasma membrane, lysosomal, vacuolar, golgi, endoplasmic reticulum, and peroxisomal compartments, based on the subcellular localization prediction of SOS1 proteins (Table 1, S1).

Table 1 Detailed information on the SOS1 gene family was identified in Kandelia obovata

Chromosomal location of the SOS1 genes in Kandelia obovata genome

The genomic chromosomal distribution of the discovered SOS1 genes in Kandelia obovata was mapped to the relevant chromosomes using the MapGene2Chromosome (MG2C) program based on the genes' chromosomal locations. The 20 SOS1 genes were distributed in 11 of the 18 chromosomes of Kandelia obovata. Chromosome 3 (Chr3) had the largest SOS1 genes at four, while chr5 had only three SOS1 genes. Each chromosome Chr6, Chr10, Chr11, Chr13, and Chr14 contained one gene, and each of the chromosomes Chr1, Chr2, Chr7 and Chr12 contained two genes (Fig. 1, Table S2). This result was in line with a previous study that analyzed repeated events in wheat, maize, potato and other species, indicating that some SOS1 family members were most likely derived from repetitive events.

Fig. 1
figure 1

Schematic diagram of the chromosomal location of Kandelia obovata's SOS1 gene family. Twenty identified SOS1 homologs genes were mapped to the 11 of 18 chromosomes. The chromosome name is at the top of each bar. The scale of the chromosome is in millions of bases (Mb)

Three-dimensional and transmembrane structure prediction

Using Clustalw, the protein sequences of the SOS1 homologs were aligned. Comparing homologs from the same subfamily, the study showed that their protein sequences were conserved (Fig. 2). Three transmembrane domains (plsC, TrkA, and cNMP) were shown to be present in SOS1s by domain analysis (PF0099) of Kandelia obovata (Fig. 2). The SOPMA/prabi tool and the SWISS-MODEL workspace were used to confirm the protein structures of KoSOS1s (Fig. 3). The results of the domain analysis indicated that the KoSOS1013174 had the plsC domain, the KoSOS1006610, and KoSOS1013784 contained the TrkA domain, the KoSOS1014977 and KoSOS1015221 contained the cNMP domain, and the KoSOS1014074 the amiloride binding domain. According to the findings, the KoSOS1 homologs may respond to abiotic stress by performing conserved tasks. The KoSOS1 proteins were accurately simulated using the templates I3NLE3.1.A (KoSOS1000168), 4bwz.1.A (KoSOS1000949, KoSOSI003751, and KoSOS1006610), 5bz2.1.A (KoSOS1004234), K7LBC1.1.A (KoSOS1009308), and A0A2P2LR79.1.A (KoSOSI014977) as depicted in Fig. 3. The range of sequence identity observed in this study varied from 16.80% to 94.36%. The maximum sequence identity was observed in KoSOS1000168, and the minimum was observed in KoSOSI003751. The values of GMQE ranged from 0.26 to 0.73. The results of this investigation show that the 3D model predictions for KoSOS1 proteins are quite accurate and show the existence of helix and strand structures. As shown in Fig. 3, the secondary structures of the SOS1 proteins from Kandelia obovata are similar to those seen in SOS1 proteins from other species.

Fig. 2
figure 2

The amino acid sequence has undergone multiple alignments utilizing data derived from each KoSOS1 gene. Sequence identity and similarity were represented by black, green, and grey letters, respectively. The asterisks (*) above the sequence represent every 10 amino acid residues

Fig. 3
figure 3

The KoSOS1s exhibit both 3D and transmembrane structures. SWISS-MODEL generates 3D structural homology models. The SOSUI tool has verified the presence of transmembrane structures

SOS1 protein phylogenetic relationships

To characterize the phylogenetic relationships among SOS1 proteins from Kandelia obovata (Ko), Arabidopsis thaliana (At), Triticum aestivum L. (Traes), Solanum tuberosum (St), Oryza sativa (Os), and Bruguiera gymnorhiza (Bg), an unrooted NJ tree was constructed. A total of 44 SOS1 proteins were used, including 20, 8, 11, 3, 1, and 1 from Kandelia obovata (Ko), Arabidopsis thaliana (At), Triticum aestivum L. (Traes), Solanum tuberosum (St), Oryza sativa (Os), and Bruguiera gymnorhiza (Bg), respectively. The SOS1 proteins were clustered into four groups, i.e., group 1 (orange), group 2 (light green), group 3 (light blue), and group 4 (light pink) (Fig. 4). Group 1 contained eight genes and had the most members (42.11%). Group 2 and Group 3 had 5 5 members (26.32%), and Group 4 had two members (10.53%), respectively. According to the phylogenetic tree, SOS1 proteins could be classified into four groups: group 1 included eight KoSOS1 proteins (KoSOS1000168, KoSOS1007241, KoSOS10014074, KoSOS1002689, KoSOS1007260, KOSOS1008568, KoSOS1007616, and KoSOS1009308), Six AtNHX proteins (AtNHX1-6), four Traes proteins (TraesCS2A02G121000, TraesCS1B02G112700, TraesCS1D02G093900, and TraesCS7A02G228400), and one StSOS1 proteins (StSOS1-33). Group 2 included five KoSOS1 proteins (KoSOS1006610, KoSOS1004234, KoSOS1012320, KoSOS1003260, and KoSOS1013784), three Traes proteins (TraesCS5B02G029000, TraesCS5D02G038600, and TraesCS5A02G030400). The group 3 comprises five KoSOS1 proteins (KoSOS1003751, KoSOS1000949, KoSOS1002250, KoSOS1013173, and KoSOS1013174), two Traes proteins (TraesCS6A02G418500, and TraesCS6D02G408100), two StSOS1 proteins (StSOS1-23, and StSOS1-28). Group 4 included two KoSOS1 proteins (KoSOS1015221 and KoSOS1014977), two AtNHX proteins (AtNHX7/8), two Traes proteins (TraesCS2A02G034700 and TraesCS3B02G021600), one OsSOS1 protein (OsSOS1-1), and one BgSOS1 protein (BgSOS1-1). The phylogenetic relationships indicate that the SOS1 proteins in the Kandelia obovata are more strongly homologous to Triticum aestivum L., Solanum tuberosum, and Arabidopsis thaliana than to Oryza sativa, and Bruguiera gymnorhiza.

Fig. 4
figure 4

A phylogenetic analysis of SOS1 proteins from Kandelia obovata (Ko), Arabidopsis thaliana (At), Triticum aestivum L. (Traes), Solanum tuberosum (St), Oryza sativa (Os), and Bruguiera gymnorhiza (Bg) was carried out using the maximum likelihood method. The SOS1 proteins were clustered into four groups, i.e., group 1 (orange), group 2 (light green), group 3 (light blue), and group 4 (light pink), each represented by a different colour

Gene structure and conserved motifs of KoSOS1 gene family

To gain a deeper comprehension of the correlation between the structure and function of these KoSOS1 proteins, an analysis of gene structure and conserved motifs was conducted to create separate phylogenies. A phylogenetic tree was constructed utilizing the individual sequences of the SOS1 protein. The SOS1 proteins were categorized into four distinct groups, and this tree represented the evolutionary groups described before. The study aimed to examine the exon–intron patterns of SOS1 genes in order to investigate gene expansion in the Kandelia obovata family. Through the analysis of exon–intron structures and conserved motifs, as illustrated in Fig. 5, we discovered that the SOS1 gene exhibits different numbers of exons (ranging from 3 to 23) and introns (ranging from 0 to 6).

Fig. 5
figure 5

Investigations were conducted into the gene structure and motif makeup of the SOS1 family genes in Kandelia obovata. The SOS1 genes found in both genomes were classified into four unique groups according to their phylogenetic links, with a specific emphasis on the gene structure of the SOS1s. The UTR sections are represented visually as green, while the CDS or exons are displayed in yellow. Introns are identified by a black horizontal line. Moreover, the preserved patterns in the SOS1s are identified by a distinct letter. Colorful boxes with distinct motifs are displayed

The number of introns of almost 60% of KoSOS1 genes was 2, while the remaining KoSOS1 genes exhibited some introns of 0 (15%), 3 (20%), and 6 (5%). The gene family known as SOS1s exhibits a diverse range of gene structures, with most SOS1 genes containing two UTR/introns. The highest count of exons identified in KoSOS1014977 and KoSOS1015221 was 23, respectively. KoSOS1013173, and KoSOS1013174, KoSOS1000949 have only three exons, while KoSOS1003751 have four exons, respectively. The results of the other six KoSOS1 genes showed that the number of exons ranged from 11 to 20, as shown in Fig. 5. The study revealed that the SOS1 genes in Kandelia obovata have a remarkably preserved gene structure, indicating a significant resemblance to their counterparts in closely related species.

To further investigate the diversity of changes in the KoSOS1 family during evolution, the conserved motifs of the 20 KoSOS1s proteins were analyzed using MEME online software, and ten different conserved motifs (named motifs 1–10) were identified (Fig. 5). The conserved motifs seen in all SOS1 genes exhibited a range of one to seven; similarly, the KoSOS1 genes displayed motifs ranging from four to 12. The results showed that motif 8 has been detected in 12 proteins. Motifs 3 and 1 were identified in 11 and 10 proteins, and motifs 2, 5, and 6 were identified in nine proteins, while motifs 4 and 7 were identified in seven. Similarly, motifs 9 and 10 were observed in four and five proteins. We also found that motifs 1–7 were primarily distributed in Group 1, motifs 1–3 in Group 2, and motifs 5 and 8 in Group 3, whereas motifs 8–10 were mainly distributed among Group 4. This study's results indicate a notable level of similarity in the gene structure and amino acid sequence across individuals belonging to the same subfamily of KoSOS1s.

Prediction of cis-elements in the promoter sequences of KoSOS1 genes

To clarify which hormonal, environmental stress, or developmental-related signal elements are involved in these KoSOS1s, we performed a promoter analysis using the PlantCARE server. A large number of basic components were discovered in the upstream sequence (2000 bp) regions, including ABRE, AuxRR-core, CGTCA-motif, ERE, GARE-motif, P-box, TATC-box, TCA, TCA-element, TGA-element, and TGACG-motif were hormonal response-related elements; A-box development-related elements, ARE, as-1, GC-motif, LTR, MBS, STRE, TC-rich repeats, and WRE3 environmental stress-related components (Fig. 6A, B, Table S3). In addition, 214 cis-elements involved in phytohormones (i.e., ABRE (58), AuxRR-core (2), CGTCA-motif (38), ERE (36), GARE-motif (4), P-box (7), TATC-box (2), TCA (4), TCA-element (19), TGA-element (5), and TGACG-motif (39), responses were also identified in the promoter sequences of SOS1 genes (Fig. 6). While 184 cis-elements involved in environmental stress-related components, including A-box (7), ARE (38), as-1 (38), GC-motif (6), LTR (11), MBS (28), STRE (39), TC-rich repeats (6), and WRE3 (11). The variation in the response components demonstrated the regulatory functions of SOS1 genes in numerous physiological and biological processes.

Fig. 6
figure 6

The KoSOS1 gene promoters contain CREs, or regulatory elements. Twenty KoSOS1 genes with diverse functions in plant growth, defense, stress response, and hormone response are represented graphically in (A). The predicted CREs' positional distribution on the KoSOS1 promoters is shown by vertical bars. In this myth, each hue symbolized distinct cis-elements. (B) The number of cis-elements was indicated by different colors. Numbers represent the number of cis-elements, while darker colors imply higher occurrence frequencies

Synteny and Duplication Analysis of the KoSOS1 Family

According to a synteny analysis, Kandelia obovata (Ko) and the other four inherited plant species, including Arabidopsis thaliana (At), Populus trichocarpa (Pt), Oryza sativa (Os), and Vitis vinifera (Vv) all have substantial orthologs of the SOS1 genes (Fig. 7). The KoSOS1 genes were unevenly distributed in different chromosomes, and some chromosomes have more KoSOS1 genes compared to others, with numbers ranging from 1 to 4 in each chromosome. Briefly, in chromosome 1, two genes of Ko displayed syntenic associations with two At-3/5, two Pt-5/13, one Os-5, and three Vv-5/8/14 chromosomes. In chromosome 2, two genes of Ko showed a collinear relationship with two At-3, two Pt-13/14, one Os-7, and two Vv-5/7 chromosomes. On the other hand, in chromosome 3, four genes of Ko showed a collinear relationship with five At-2 (2) and At5 (3), six Pt-6/10/12/14/15/18, two Os-11/12, and two Vv-8/18 chromosomes. In chromosome 5, three genes of Ko displayed syntenic associations with two At-3/5, four Pt-5/9/13/14, one Os-5, and three Vv-3/5/14 chromosomes. In chromosome 6, one gene of Ko showed a collinear relationship with one Pt16 chromosome, while in chromosome 7, two genes of Ko showed a syntenic relationship with one At-5, one Pt-16, and one Vv-19 chromosome. Similarly, each one gene of Ko displayed syntenic associations with chromosome 10 (two At-2/5, two Pt-6/18, and one Vv-11), chromosome 11 (two At-1/5, two Pt-1/3, and one Vv-2), chromosome 13 (two At-1/4, two Pt-8/10, and one Vv-1), and chromosome 14 (two At-2, two Pt-8/10, and one Vv-1). In chromosome 12, two genes of Ko showed a collinear relationship with one At-1, two Pt-2/14, two Os-5/7, and two Vv-5/15 chromosomes. The KoSOS1s gene family was largely shaped by segmental repetition and whole-genome duplication, as evidenced by the survival of several homologs of the genus Kandelia obovata (KoSOS1s) in syntenic associations with Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, and Vitis vinifera.

Fig. 7
figure 7

SOS1 gene synteny study in the chromosomes of Vitis vinifera, Oryza sativa, Populus trichocarpa, Arabidopsis thaliana, and Kandelia obovata. Kandelia obovata's and the other four plant species' genomes' collinear blocks are highlighted by the other colored lines, while the background's grey lines draw attention to the syntenic SOS1 gene pairs. The box's many colors stood for different kinds of plants

Multiple homologs of Kandelia obovata, known as KoSOS1s, have consistently coexisted with Arabidopsis thaliana, Solanum tuberosum, Populus trichocarpa, Vitis vinifera, and Oryza sativa through a syntenic relationship. This discovery indicates that both the repeating of segments and the duplication of the entire genome were important factors in the evolution of the KoSOS1s gene family. New gene families and plant genomes are encouraged to evolve through segmental and tandem duplication. To gain a deeper understanding of the duplication activities of the Kandelia obovata SOS1 gene, we conducted an investigation into the segmental and tandem duplications within the KoSOS1 gene family. The chromosomal dispersals of nine KoSOS1 genes were evaluated. Five sets of duplicated genes were found, as shown in Fig. 8. The investigation revealed a single instance of segmental duplication involving the gene pairs KoSOS1000168 and KoSOS1007241, KoSOS1002689 and KoSOS1007260, KoSOS1002689 and KoSOS1014074, KoSOS1004234 and KoSOS1012320, and KoSOS1014977 and KoSOS1015221 on chromosomes Chr1 and Chr5, Chr2 and Chr6, Chr2 and Chr12, Chr3 and Chr10, and Chr13 and Chr14. Significantly, the KoSOS1 gene was not present on the other chromosomes.

Fig. 8
figure 8

The KoSOS1 gene's chromosomal distribution and interchromosomal connections are shown as circles. The syntenic blocks in the genome of Kandelia obovata are shown by the grey lines in the background, while the red and blue lines represent the syntenic SOS1 gene pair

A thorough investigation was conducted to determine the Ka (non-synonymous substitution rate), Ks (synonymous substitution rate), and the Ka/Ks ratio for the Kandelia obovata SOS1 gene family, with the aim of enhancing our understanding of the evolutionary limitations that impact it. The duplicated gene pairs of KoSOS1s showed Ka/Ks ratios of 1.21, 1.03, 0.79, 1.56, and 0.88. This indicates that the SOS1 gene family in Kandelia obovata may have experienced selective pressures or a discriminating load during their evolutionary history (Table 2).

Table 2 Detailed information on the Ka, Ks, and Ka/Ks ratio in Kandelia obovata

Expression analysis of SOS1 genes Kandelia obovata leaves under salt stress

We used qRT-PCR to examine the SOS1 gene expression level in Kandelia obovata leaves under five different salt stress conditions (S0, S5, S10, S15, and S20%). A total of seven SOS1 genes were examined: KoSOS1009038, KoSOS000168, KoSOS1014977, KoSOS1006610, KoSOS1004234, KoSOS1000949, and KoSOS1003751 (Fig. 9). When compared to control (S5%), salt-stressed leaves (S20%) exhibited considerably higher (p < 0.05) expression levels of the KoSOS1009038 gene. In S10% and S15%, the expression level of KoSOS1009038 did not change (p > 0.05); however, in S25%, it did significantly decline (p < 0.05) in comparison to the control. The KoSOS000168 gene was expressed at significantly greater (p < 0.05) levels in salt-stressed leaves (S10% and S15%) compared to the control. Compared to the control, KoSOS000168's expression level significantly decreased (p < 0.05) in S25% but did not change in S20% (p > 0.05). In response to the S20%, the KoSOS1014977 gene showed statistically significant (p < 0.05) up-regulation in expression when compared to the control group (Cu0), but it remained unchanged (p > 0.05) in the S10% and S15%. In S25%, KoSOS1014977 expression level considerably (p < 0.05) decreased compared to the control. When comparing salt-stressed leaves (S10%) to control, the expression of the KoSOS1006610 gene was considerably higher (p < 0.05). The expression level of KoSOS1006610 considerably decreased (p < 0.05) in S15%, S20%, and S25% treatment compared to the control. The expression level of the KoSOS1004234 gene did not significantly alter (p > 0.05) in S5%, S10%, S15%, and S20% treatments, it did considerably decrease (p < 0.05) in S25% compared to the control. In comparison to the control, only one KoSOS1000949 gene was expressed at significantly down-regulated (p < 0.05) levels in all salt-stressed leaves (S10%, S15%, S20%, and S25%). When the KoSOS1003751 gene was compared to the control group (Cu0) in the S20%, there was a statistically significant (p < 0.05) up-regulation in expression; however, in the S10% and S15%, there was no change (p > 0.05). The expression level of KoSOS1003751 in S25% was significantly (p < 0.05) lower than that of the control. When subjected to S25% salt stress, all SOS1 genes demonstrated significant down-regulation, while KoSOS1000949 showed significant down-regulation in all salt stress conditions (Fig. 9).

Fig. 9
figure 9

shows the results of the qRT-PCR study measuring KoSOS1 expression in leaves of seedling-stage Kandelia obovata plants under different salt stress levels (S0, S5, S10, S15, and S20%). Using the Least Significant Difference (LSD) test, there is a significant difference (p < 0.05) between all conditions and the control group. An asterisk (*) is used to indicate the presence of significant discrepancies. A single asterisk (*) denotes a significance level of p < 0.05, whereas two asterisks (**) imply a significance level of p < 0.001. The vertical axis represents the relative gene expression, whereas the horizontal axis depicts the KoSOS1 genes

Expression analysis of SOS1 genes Kandelia obovata leaves under copper stress

The expression level of the SOS1 gene in Kandelia obovata leaves was analyzed under five distinct copper stress conditions (Cu0, Cu50, Cu100, Cu200, and Cu400 mg L−1) using qRT-PCR. Seven SOS1 genes (KoSOS1009038, KoSOS000168, KoSOS1014977, KoSOS1006610, KoSOS1004234, KoSOS1000949, and KoSOS1003751) were investigated (Fig. 10). Expression levels of the KoSOS1009038 gene were increased (p < 0.05) in copper-stressed leaves (Cu100 and Cu400) compared to control. The expression level of KoSOS1009038 remained unchanged (p > 0.05) in Cu50, while in Cu200, the expression level decreased (p < 0.05) compared to the control. The expression levels of KoSOS000168 and KoSOS1014977 genes did not show statistical significance when comparing the KoSOS000168 expression in Cu50, 100, and 400, while KoSOS1014977 expression in Cu50, 100, and 200 with the control group. However, these genes exhibited statistically significant up-regulation in the Cu200 and Cu400 groups compared to the Cu0 group. The KoSOS1006610 gene remained unchanged (p > 0.05) in Cu50, while it showed statistically significant (p < 0.05) up-regulation in expression in response to the Cu100, Cu200, and Cu400 treatment, as compared to the control group (Cu0). Only two genes, KoSOS1004234 and KoSOS1000949, exhibited statistically significant up-regulation in the Cu50, Cu100, Cu200 and Cu400 groups compared to the Cu0 group. The expression level of the KoSOS1003751 gene was up-regulated in Cu50, Cu200, and Cu400 but non-significant in Cu100 as compared to Cu0 treatment. Comparison among KoSOS1 genes KoSOS1009038 showed significant down-regulation, while KoSOS1004234 and KoSOS1000949 showed significant up-regulation under copper stress. Genes including KoSOS1009038, KoSOS000168, KoSOS1014977, KoSOS1006610, and KoSOS1003751 showed no significant change in expression (Fig. 10).

Fig. 10
figure 10

Using qRT-PCR, the expression of KoSOS1s was investigated in the leaves of seedling-stage Kandelia obovata plants under various copper stress conditions (Cu0, Cu50, Cu100, Cu200, and Cu400 mg L−1). The Least Significant Difference (LSD) test confirms a statistically significant difference (p < 0.05) between the control group and all treatment groups. An asterisk (*) is used to indicate the presence of significant differences, with * representing a significance level of p < 0.05 and ** representing a significance level of p < 0.001. The vertical axis represents the relative gene expression, whereas the horizontal axis depicts the KoSOS1 genes

When comparing the effects of salt and copper stress, it was observed that most genes exhibited reduced expression under all salt stress levels. The results indicate that nearly all of the SOS1 genes exhibited considerable down-regulation under S25% salt stress. When comparing the KoSOS1 genes, it was shown that KoSOS1009038 exhibited a considerable decrease in expression, but KoSOS1004234 and KoSOS1000949 showed a large increase in expression in response to copper stress. KoSOS1000949 exhibited considerable down-regulation under all salt stress conditions, while it displayed significant up-regulation under all copper stress levels.

Discussion

Soil salinity is a major abiotic stress that crop plants in agricultural field’s worldwide encounter, resulting in a decrease in crop yield and production. Plants have developed the SOS pathway as a means to attain salt tolerance [20, 34]. The SOS pathway, which consists of SOS1, SOS2, and SOS3, is believed to regulate cellular signaling in response to salt stress in order to maintain ion balance [35]. SOS1 has a crucial role in determining the resistance of plants to salt [22]. The SOS1 genes have been documented to enhance salt stress resistance in various plant species, including potato [20], wheat [29], tuber mustard [21], Arabidopsis [6, 23], and quinoa [31]. Copper (Cu) is a vital element for all living species. The transport of Cu through the cell membrane is a critical step in maintaining Cu homeostasis [15]. Multiple transporter protein types have been reported to facilitate the absorption of copper [36]. Nevertheless, there is currently no information available regarding the response of the SOS1 genes in the common woody mangrove species Kandelia obovata to copper-induced stress. In this study, we utilized genome-wide analysis to identify a reduced SOS1 gene family consisting of 20 members from the genome of Kandelia obovata.

Kandelia obovata and B. sexangula are two types of mangrove species that belong to the Rhizophoraceae Pers. Family [37]. These species are known for their ability to exclude salt and are also related with the management of heavy metals [38,39,40,41]. Kandelia obovata, a type of woody plants, is primarily located in salt marshes throughout tropical and subtropical areas spanning from East Asia to Southeast Asia [41, 42]. Kandelia obovata successfully adapts to transitional habitats where the land and ocean meet, while facing both regular and irregular tidal forces. These influences lead to elevated salinity levels, significant erosion, and oxygen-deprived conditions [43]. Mangrove trees are tolerant to high salinity levels and can withstand considerable daily and yearly fluctuations in salinity. Gaining a comprehensive understanding of the molecular-level salinity tolerance mechanism in mangroves is crucial for the development of crops that can potentially be grown using the plentiful seawater [44]. Prior research has shown that mangrove seedlings can thrive in environments with exceptionally high levels of heavy metals [37, 38], and endure salt stress [45, 46], albeit with detrimental impacts on their growth. Mangroves possess a significant capacity to accumulate metals, enabling them to serve as a biogeochemical buffer for heavy metal contaminants. This capability has been demonstrated in several studies [37, 38, 40, 47]. This study aims to identify crucial KoSOS1 genes that exhibit heightened sensitivity to abiotic stress. The objective is to establish a foundation for investigating the regulatory mechanisms of SOS1 genes in Kandelia obovata.

The KoSOS1 genes are crucial in plants for their response to salt and copper stress. In this study, a total of 20 proteins belonging to the Kandelia obovata SOS1 family were classified into four distinct groups. The identification of six SOS genes, namely SOS1, SOS2, SOS3, SOS4, SOS5, and SOS6, was reported in Arabidopsis [23]. Plants that have been genetically modified to produce higher levels of AtNHX1 or SOS1 have shown a notable improvement in their ability to withstand high salt levels [23]. Researchers discovered a total of 37, 119, and 12 SOS1 gene families in potato [20], wheat [29], and tuber mustard [21]. The SOS1 protein is produced by the SOS1 gene and acts as a hypothetical plasma membrane Na+/H+ antiporter, responsible for removing Na+ ions from plant cells. Thus, it helps maintain the balance of K+ and Na+ levels in plant cells and prevents the buildup of Na+ in plant cells [20, 21, 29, 32]. Our work discovered a greater number of SOS1 gene families in the Kandelia obovata genome, which is noteworthy. Our findings indicate that there are 20 SOS1 homologs present in the genome of Kandelia obovata. The number of SOS1 genes in the Kandelia obovata genome exceeds that in tuber mustard, primarily due to Kandelia obovata being an allopolyploid species.

El Mahi et al. [48] demonstrated that SOS1 genes are crucial in facilitating plants' reactions to salt stress. Nevertheless, there has been no comprehensive examination conducted on the SOS1 gene family in wheat, particularly regarding its expression patterns when subjected to salt stress. The chromosomal positions and collinearity suggest that segmental duplications are significant in the proliferation of SOS1 members in wheat [29]. The phylogenetic analysis revealed that the SOS1 genes obtained from Kandelia obovata and five additional plant species, specifically Arabidopsis thaliana (At), Triticum aestivum L. (Traes), Solanum tuberosum (St), Oryza sativa (Os), and Bruguiera gymnorhiza (Bg), were classified into four main groups. The current investigation entailed the discovery of 20 SOS1 genes from the genome of Kandelia obovata. A phylogenetic analysis was performed, revealing that KoSOS1s and Solanum tuberosum (StSOS1s) exhibited the most closely related relationship [20].

Based on our subcellular localization prediction of SOS1 proteins, we identified 20 KoSOS1s that are most likely located in the plasma membrane. The subcellular localization of proteins has a crucial role in defining the function and accumulation patterns of plant proteins [49]. The expression of CcSOS1 in Chrysanthemum crassum was seen in close proximity to the plasma membrane in onion epidermal cells that were temporarily converted [50]. The expression of SOS1 genes in the plasma membrane was anticipated in potato [20], wheat [29], and tuber mustard [21]. The cis-elements and functional properties of SOS1 gene promoters have been found in many species, including potato [20], wheat [29], and tuber mustard [21]. In this study, we conducted an investigation of cis-acting regulatory elements in the promoter region of SOS1s in Kandelia obovata to gain a deeper understanding of their potential function. The cis-regulatory elements were discovered to encompass phytohormone and abiotic stressors, aligning with earlier research findings in other species [20].

Various investigations have confirmed that KoSOS1s play a role in numerous physiological reactions to salt and heavy metal exposure. The main aim of this work was to investigate the influence of salt and Cu stress on the expression of KoSOS1, a particular gene. The findings indicated that the expression levels of KoSOS1 genes were seen to be both upregulated and downregulated in response to both salt and copper stress. Arabidopsis plants that have been genetically modified to have higher levels of the wheat SOS1 gene have enhanced ability to withstand the negative effects of salt stress, as demonstrated in a study by Jiang et al. [29]. Prior research has demonstrated that SOS1 is increased in response to salt stress in Arabidopsis [51]. The expression of SOS1 was markedly increased in leaf tissue during NaCl stress (450 mmol/L) [31]. It may be possible to improve crops' and plants' resistance to high salt and copper concentrations by using the KoSOS1 genes as useful genetic modifiers. Some SOS1 genes in potato showed both up-regulation and down-regulation in response to various stress conditions [20]. Comparably, in wheat, the transcriptome analysis showed that, under salinity stress, 28 and 26 genes, respectively, were up- and down-regulated; of these, 18 genes were further validated by RT-qPCR [29]. Similarly, in Kandelia obovata, SOS1 genes were also found to be up-regulated and down-regulated in the presence of salt and copper stress.

Conclusions

Kandelia obovata's genome has 20 KoSOS1s, according to this study's genome-wide examination of the KoSOS1 genes. To learn more about the evolution of the SOS1 gene family in the Kandelia obovata genome, various analyses were carried out, including gene identification, subcellular localization, chromosomal distributions, domain and 3D structural variation, phylogenetic tree, synteny and duplication analyses, gene structure, motif analysis, cis-regulatory elements, and expression profiling against different salt and copper treatments. KoSOS1 genes were found on Kandelia obovata's 11 chromosomes. Four groups were identified by the phylogenetic analysis based on the SOS1 proteins found in Kandelia obovata, Arabidopsis thaliana, Triticum aestivum L., Solanum tuberosum, Oryza sativa, and Bruguiera gymnorhiza. According to the expression profiles, most KoSOS1 genes expressed themselves specifically in leaves and were mainly responsible for salt and copper resistance to stressful conditions. These results will also make identifying putative genes that improve plant architecture in response to stressors easier and pave the way for future KoSOS1 gene breeding and genetic upgrades in other crops. These procedures may use CRISPR/Cas-mediated deletion, overexpression, and other genetic changes.

Materials and Methods

Identification and characterization of SOS1 genes in Kandelia obovata

The NCBI database (https://www.ncbi.nlm.nih.gov/, BioProject/GWH, Accession codes: PRJCA002330/GWHACBH00000000) and the Kandelia obovata protein database (https://www.omicsclass.com/article/310) were used to acquire the genomic sequences for Kandelia obovata [42]. The hypothetical proteins were cross-referenced and validated using two databases: NCBI CDD (with an E-value of 1.2e-28) and Pfam (available at http://pfam.xfam.org/). The protein sequence analysis of SOS1, which is connected with the domain profile, was conducted using the Pfam database available at http://pfam.xfam.org. Twenty SOS1 family genes were found and verified using the NCBI database (https://www.ncbi.nlm.nih.gov/) and the Kandelia obovata genome database (https://www.omicsclass.com/article/310) (Table S4, S5). Protparam (http://web.expasy.org/protparam/) was utilized to analyze the physicochemical properties.

Chromosomal distribution of SOS1 genes in Kandelia obovata

All of the SOS1 genes in Kandelia obovata have their genomic locations and protein sequences determined using the NCBI database and https://www.omicsclass.com/article/310. We also examined the chromosomal distribution of SOS1 genes. The MapGene2Chromosome (MG2C) tool, available at http://mg2c.iask.in/mg2c v2.0/, was used to determine the chromosomal location of SOS1 genes in Kandelia obovata.

Phylogenetic tree construction

The protein sequences of SOS1 genes from the following species were used in the phylogenetic analysis: Kandelia obovata (Ko), Bruguiera gymnorhiza (Bg), Triticum aestivum L. (Traes), Oryza sativa (Os), and Solanum tuberosum (St). The MEGA11 (V 6.06) software, available at www.megasoftware.net, was commonly utilized for protein sequence alignment. The phylogenetic tree was constructed using the neighbour-joining (NJ) method with 1000 bootstrap replicates. The phylogenetic tree was seen and modified using Fig Tree V1.4.4.

Gene structure and significant motif analyses of the SOS1 family members

Kandelia obovata's genome contains a total of twenty (20) genes belonging to the SOS1 family. Web software (http://gsds.cbi.pku.edu.cn) determined the structural analyses of 20 SOS1 genes and showed the exon/intron arrangements of the SOS1 genes. Among the protein sequences of the 20 SOS1 proteins, the online program MEME v5.4.1, accessible at https://meme-suite.org/meme/tools/glam2scan, identified more conserved regions or groups. The program used the following settings: sequence alphabet (DNA, RNA, or protein); site distribution (zero or one occurrence per sequence; classic mode for motif searching), and 10 motifs. The MEME findings were displayed using the TBtools application after downloading the corresponding mast file.

Synteny and duplication analysis

SOS1 gene synteny connections were determined in Arabidopsis thaliana (At), Populus trichocarpa (Pt), Oryza sativa (Os), and Vitis vinifera (Vv) using the Minspan method (available online). To investigate the evolutionary constraints of each SOS1 gene pair, the synonymous (Ks), non-synonymous (Ka), and Ka/Ks ratios were calculated using the KaKs Calculator 2.0 (https://sourceforge.net/projects/kakscalculator2/).

Analysis and prediction of cis-acting elements of the SOS1 family

The Kandelia obovata genome assembly database was used to collect two thousand (2000 bp) upstream sequences of SOS1 family members. The PlantCARE tool (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) was utilized to detect cis-regulatory elements (CREs) in the obtained sequences. Figure 6 in TBtools was generated using the most prevalent cis-regulatory elements (CREs) identified for the SOS1 genes based on the frequency count of each CRE motif.

3D structure and subcellular localization

SWISS-MODEL (https://swissmodel.expasy.org/interactive) can be used to estimate the three-dimensional (3D) structure.

Secondary structure refers to the local folding patterns of a protein or nucleic acid, precisely the arrangement of its amino acid or nucleotide residues. NPS@: SOPMA is a secondary structure prediction tool available at ibcp.fr.

Link to the transmembrane structure: https://services.healthtech.dtu.dk/services/TMHMM-2.0/

The subcellular location of the SOS1 family genes was predicted using two online tools.

(1) ProtComp 9.0 can be accessed at the following link: http://linux1.softberry.com/berry.phtml?topic=protcomppl&group=programs&subgroup=proloc

The user has entered the word "CELLO". Server: cello.life.nctu.edu.tw/.

Plant material and environmental conditions

The research used one-year-old Kandelia obovata seedlings, three treatments, ten to twelve plants per treatment, and three replications. The seedlings were got and planted in the mangrove conservation site at Golden Bay Mangrove Reserve, which is located in Beihai, Guangxi Province, China. The site is located at the geographical coordinates of 109.22° N and 21.42° E. The soil was irrigated with CuCl2 solution and received regular morning and evening watering with seawater from the nearby area, as part of semi-natural agricultural techniques. Five different CuCl2 concentrations (0, 50, 100, 200, and 400 mg/L) were used for the treatments during two years. These concentrations are Cu0, Cu50, Cu100, Cu200, and Cu400. A starting concentration of 0 mg/L of Cu0 was used in the control treatment, which used local seawater. The soil sample utilized in this experiment had a Cu concentration below 1.0%, which was categorized as non-polluted [48]. The different salt concentrations were given twice a day after the transplanting, using either pure seawater or a combination of saltwater and sea salt to obtain the appropriate level of salinity. Seawater samples were taken near the shore as necessary between November 2017 and November 2019. From 2017 to 2018, the average salinity was recorded to be 19.74 ± 1.14% (n = 21). However, from 2019 to 2020, the average salinity increased to 22.12 ± 0.69% (n = 39). The concentrations of 5, 10, 15, 20, and 25% were represented by the five distinct salt levels—S5, S10, S15, S20, and S25. A starting concentration of S5% was used in the control treatment, which used local seawater. Plant samples were gathered to evaluate the various parameters after two years of salt and copper treatments. Our recently published paper Shang et al. [9] and Liao et al. [52] describes the precise procedures and quantification of soil characteristics, including the application of Cu and salt solution, evaluation of soil properties, and Cu and salt content in soil.

Quantitative Real-Time PCR Assays

With the help of TRIzol (Invitrogen, http://www.invitrogen.com), total RNA was isolated from the leaves previously indicated. Quantitative real-time PCR (qRT-PCR) testing was carried out using the 2−∆∆CT method on ABI PRISM 7500 Real-time PCR Systems from Applied Biosystems. Table 3 includes a comprehensive list of the exact KoSOS1 gene primers used in this study. These primers were produced using the primerdesigning tool provided by the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/. The actin gene (GWH-TACBH010383.1) was utilized as an internal control. Based on the sequence provided by Sun et al. [53], the reference gene for Kandelia obovata (KoActin) was chosen. Primers CAATGCAGCAGTTGAAGGAA and CTGCTGGAAGGAACCAAGAG were used as the forward and reverse primers, respectively. The statistical analysis was performed using GraphPad Prism 9.0.0, and the Student's t-test was conducted.

Table 3 Information about the primers used in this study's gene expression analysis by qRT-PCR

Statistical analysis

The data was analyzed using one-way ANOVA in SPSS version 13.0. The results were shown as the mean SD (Standard Deviation) of the three replicates. Five different copper stress levels (Cu0, Cu50, Cu100, Cu200, and Cu400 mg L−1) and five different salt levels (S5, S10, S15, S20, and S25%) were compared for differences in leaf mean values using an LSD (least significant difference) test at p < 0.05. The statistical software GraphPad Prism 9 (https://www.graphpad.com; was used to make the graphs.

Availability of data and materials

Data pertaining to the study have been included in the article or as supplementary material, further inquiries can be directed to the corresponding author.

References

  1. Hussain Q, Asim M, Zhang R, Khan R, Farooq S. Transcription Factors Interact with ABA through Gene Expression and Signaling Pathways to Mitigate Drought and Salinity Stress. Biomolecules. 2021;11:1159.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. He M, He CQ, Ding NZ. Abiotic stresses: General defenses of land plants and chances for engineering multistress tolerance. Front Plant Sci. 2018;871 December:1–18.

  3. Cramer GR, Urano K, Delrot S, Pezzotti M, Shinozaki K. Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol. 2011;11:1–14.

    Article  Google Scholar 

  4. Waqas MA, Kaya C, Riaz A, Farooq M, Nawaz I, Wilkes A, et al. Potential Mechanisms of Abiotic Stress Tolerance in Crop Plants Induced by Thiourea. Front Plant Sci. 2019;10 October:1–14.

  5. Zhu JK. Abiotic Stress Signaling and Responses in Plants. Cell. 2016;167:313–24.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Zhang Y, Zhou J, Ni X, Wang Q, Jia Y, Xu X, et al. Structural basis for the activity regulation of Salt Overly Sensitive 1 in Arabidopsis salt tolerance. Nat Plants. 2023;9:1915–23.

    Article  CAS  PubMed  Google Scholar 

  7. Yang Y, Guo Y. Unraveling salt stress signaling in plants. J Integr Plant Biol. 2018;60:796–804.

    Article  CAS  PubMed  Google Scholar 

  8. Zhu JK. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol. 2002;53:247–73.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Shang C, Chen J, Nkoh JN, Wang J, Chen S, Hu Z, et al. Biochemical and multi-omics analyses of response mechanisms of rhizobacteria to long-term copper and salt stress: Effect on soil physicochemical properties and growth of Avicennia marina. J Hazard Mater. 2024;466 January:133601.

  10. Sudhir S, Arunprasath A, Sankara Vel V. A critical review on adaptations, and biological activities of the mangroves. J Nat Pestic Res. 2022;1 February:100006.

  11. Alhassan AB, Aljahdali MO. Sediment Metal Contamination, Bioavailability, and Oxidative Stress Response in Mangrove Avicennia marina in Central Red Sea. Front Environ Sci. 2021;9 June:1–15.

  12. Yuan M, Li X, Xiao J, Wang S. Molecular and functional analyses of COPT/Ctr-type copper transporter-like gene family in rice. BMC Plant Biol. 2011;11:69.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Hu Z, Fu Q, Zheng J, Zhang A, Wang H. Transcriptomic and metabolomic analyses reveal that melatonin promotes melon root development under copper stress by inhibiting jasmonic acid biosynthesis. Hortic Res. 2020;7:79.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Cano-Gauci DF, Sarkar B. Reversible zinc exchange between metallothionein and the estrogen receptor zinc finger. FEBS Lett. 1996;386:1–4.

    Article  CAS  PubMed  Google Scholar 

  15. Hussain Q, Ye T, Li S, Nkoh JN, Zhou Q, Shang C. Genome-Wide Identification and Expression Analysis of the Copper Transporter (COPT/Ctr) Gene Family in Kandelia obovata, a Typical Mangrove Plant. Int J Mol Sci. 2023;24:15579.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Peñarrubia L, Andrés-Colás N, Moreno J, Puig S. Regulation of copper transport in Arabidopsis thaliana: A biochemical oscillator? J Biol Inorg Chem. 2010;15:29–36.

    Article  PubMed  Google Scholar 

  17. Burkhead JL, Gogolin Reynolds KA, Abdel-Ghany SE, Cohu CM, Pilon M. Copper homeostasis. New Phytol. 2009;182:799–816.

    Article  CAS  PubMed  Google Scholar 

  18. Shen X, Li R, Chai M, Cheng S, Niu Z, Qiu GY. Interactive effects of single, binary and trinary trace metals (lead, zinc and copper) on the physiological responses of Kandelia obovata seedlings. Environ Geochem Health. 2019;41:135–48.

    Article  CAS  PubMed  Google Scholar 

  19. Hussain Q, Ye T, Shang C, Li S, Nkoh JN, Li W, et al. Genome-Wide Identification, Characterization, and Expression Analysis of the Copper-Containing Amine Oxidase Gene Family in Mangrove Kandelia obovata. Int J Mol Sci. 2023;24:17312.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Liang L, Guo L, Zhai Y, Hou Z, Wu W, Zhang X, et al. Genome-wide characterization of SOS1 gene family in potato (Solanum tuberosum) and expression analyses under salt and hormone stress. Front Plant Sci. 2023;14 June:1201730.

  21. Cheng C, Zhong Y, Wang Q, Cai Z, Wang D, Li C. Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. Tumida). PLoS One. 2019;14:1–19.

  22. Świeżawska B, Duszyn M, Jaworski K, Szmidt-Jaworska A. Downstream targets of cyclic nucleotides in plants. Front Plant Sci. 2018;9 October:1–7.

  23. Yang Q, Chen ZZ, Zhou XF, Yin HB, Li X, Xin XF, et al. Overexpression of SOS (salt overly sensitive) genes increases salt tolerance in transgenic Arabidopsis. Mol Plant. 2009;2:22–31.

    Article  CAS  PubMed  Google Scholar 

  24. Keisham M, Mukherjee S, Bhatla SC. Mechanisms of sodium transport in plants—Progresses and challenges. Int J Mol Sci. 2018;19:647.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Zhao C, William D, Sandhu D. Isolation and characterization of Salt Overly Sensitive family genes in spinach. Physiol Plant. 2021;171:520–32.

    Article  CAS  PubMed  Google Scholar 

  26. Shi H, Ishitani M, Kim C, Zhu JK. The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc Natl Acad Sci U S A. 2000;97:6896–901.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Gao J, Sun J, Cao P, Ren L, Liu C, Chen S, et al. Variation in tissue Na+ content and the activity of SOS1 genes among two species and two related genera of Chrysanthemum. BMC Plant Biol. 2016;16:98.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Núñez-Ramírez R, Sánchez-Barrena MJO, Villalta I, Vega JF, Pardo JM, Quintero FJ, et al. Structural insights on the plant salt-overly-sensitive 1 (SOS1) Na+/H+ antiporter. J Mol Biol. 2012;424:283–94.

    Article  PubMed  Google Scholar 

  29. Jiang W, Pan R, Buitrago S, Wu C, Abou-Elwafa SF, Xu Y, et al. Conservation and divergence of the TaSOS1 gene family in salt stress response in wheat (Triticum aestivum L.). Physiol Mol Biol Plants. 2021;27:1245–60.

  30. Cao Y, Shan T, Fang H, Sun K, Shi W, Tang B, et al. Genome-wide analysis reveals the spatiotemporal expression patterns of SOS3 genes in the maize B73 genome in response to salt stress. BMC Genomics. 2022;23:1–13.

    Article  Google Scholar 

  31. Maughan PJ, Turner TB, Coleman CE, Elzinga DB, Jellen EN, Morales JA, et al. Characterization of Salt Overly Sensitive 1 (SOS1) gene homoeologs in quinoa (Chenopodium quinoa Willd.). Genome. 2009;52:647–57.

  32. Zhang M, Cao J, Zhang T, Xu T, Yang L, Li X, et al. A Putative Plasma Membrane Na+/H+ Antiporter GmSOS1 Is Critical for Salt Stress Tolerance in Glycine max. Front Plant Sci. 2022;13 May:870695.

  33. Zhou X, Li J, Wang Y, Liang X, Zhang M, Lu M, et al. The classical SOS pathway confers natural variation of salt tolerance in maize. New Phytol. 2022;236:479–94.

    Article  CAS  PubMed  Google Scholar 

  34. Cha JY, Kim J, Jeong SY, Shin GI, Ji MG, Hwang JW, et al. The Na+/H+ antiporter SALT OVERLY SENSITIVE 1 regulates salt compensation of circadian rhythms by stabilizing GIGANTEA in Arabidopsis. Proc Natl Acad Sci U S A. 2022;119: e2207275119.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Luo B, Guang M, Yun W, Ding S, Ren S, Gao H. Camellia sinensis Chloroplast Fluoride Efflux Gene CsABCB9 Is Involved in the Fluoride Tolerance Mechanism. Int J Mol Sci. 2022;23:7756.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Hussain Q, Ye T, Shang C, Li S, Mustafa AEMA, Elshikh MS. NRAMP gene family in Kandelia obovata: genome-wide identification, expression analysis, and response to five different copper stress conditions. Front Plant Sci. 2024;14:1318383.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Ma L, Yang S. Growth and physiological response of Kandelia obovata and Bruguiera sexangula seedlings to aluminum stress. Environ Sci Pollut Res. 2022;29:43251–66.

    Article  CAS  Google Scholar 

  38. Dai M, Lu H, Liu W, Jia H, Hong H, Liu J, et al. Phosphorus mediation of cadmium stress in two mangrove seedlings Avicennia marina and Kandelia obovata differing in cadmium accumulation. Ecotoxicol Environ Saf. 2017;139 January:272–9.

  39. Zhang F, Wang Y, Lou Z. Effect of heavy metal stress on antioxidative enzymes and lipidperoxidation in leaves and roots of two mangrove plant seedlings (Kandelia candel and Bruguiera gymnorrhiza). Chemosphere. 2007;67:44–50.

    Article  CAS  PubMed  Google Scholar 

  40. MacFarlane GR, Koller CE, Blomberg SP. Accumulation and partitioning of heavy metals in mangroves: A synthesis of field-based studies. Chemosphere. 2007;69:1454–64.

    Article  CAS  PubMed  Google Scholar 

  41. Hu MJ, Sun WH, Tsai WC, Xiang S, Lai XK, Chen DQ, et al. Chromosome-scale assembly of the Kandelia obovata genome. Hortic Res. 2020;7:75.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Sheue CR, Liu HY, Yong JWH. Kandelia obovata (Rhizophoraceae), a new mangrove species from Eastern Asia. Taxon. 2003;52:287–94.

    Article  Google Scholar 

  43. Wang CW, Wong SL, Liao TS, Weng JH, Chen MN, Huang MY, et al. Photosynthesis in response to salinity and submergence in two Rhizophoraceae mangroves adapted to different tidal elevations. Tree Physiol. 2022;42:1016–28.

    Article  CAS  PubMed  Google Scholar 

  44. Natarajan P, Murugesan AK, Govindan G, Gopalakrishnan A, Kumar R, Duraisamy P, et al. A reference-grade genome identifies salt-tolerance genes from the salt-secreting mangrove species Avicennia marina. Commun Biol. 2021;4:851.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Wang HM, Xiao XR, Yang MY, Gao ZL, Zang J, Fu XM, et al. Effects of salt stress on antioxidant defense system in the root of Kandelia candel. Bot Stud. 2014;55:55–7.

    Article  Google Scholar 

  46. Xing J, Pan D, Wang L, Tan F, Chen W. Proteomic and physiological responses in mangrove kandelia candel roots under short-term high-salinity stress. Turkish J Biol. 2019;43:314–25.

    Article  CAS  Google Scholar 

  47. Zhou Y wu, Zhao B, Peng Y sheng, Chen G zhu. Influence of mangrove reforestation on heavy metal accumulation and speciation in intertidal sediments. Mar Pollut Bull. 2010;60:1319–24.

  48. Mahi H El, Pérez-hormaeche J, Luca A De, Villalta I, Espartero J, Gámez-arjona F, et al. A Critical Role of Sodium Flux via the Plasma Membrane Na+/H+ Exchanger SOS1 in the Salt Tolerance. Plant Physiol. 2019;180 June:1046–65.

  49. Castleden IR, Aryamanesh N, Black K, Grasso SV, Millar AH. CropPAL for discovering divergence in protein subcellular location in crops to support strategies for molecular crop breeding. Plant J. 2020;104:812–27.

    Article  PubMed  Google Scholar 

  50. Song A, Lu J, Jiang J, Chen S, Guan Z, Fang W, et al. Isolation and characterisation of Chrysanthemum crassum SOS1, encoding a putative plasma membrane Na+⁄H+ antiporter. Plant Biol. 2012;14:706–13.

    Article  CAS  PubMed  Google Scholar 

  51. Donaldson L, Ludidi N, Knight MR, Gehring C, Denby K. Salt and osmotic stress cause rapid increases in Arabidopsis thaliana cGMP levels. FEBS Lett. 2004;569:317–20.

    Article  CAS  PubMed  Google Scholar 

  52. Liao J, Xu Y, Zhang Z, Zeng L, Qiao Y, Guo Z, et al. Effect of Cu addition on sedimentary bacterial community structure and heavy metal resistance gene abundance in mangrove wetlands. Front Mar Sci. 2023;10 April:1157905.

  53. Sun MM, Liu X, Huang XJ, Yang JJ, Qin PT, Zhou H, Jiang MG, Liao HZ. Genome-Wide Identification and Expression Analysis of the NAC Gene Family in Kandelia Obovata, a Typical Mangrove Plant. Curr Issues Mol Biol. 2022;44:5622–37.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We thank Instrument Analysis Center of Shenzhen University. We are also grateful for the support from the public service platform of instruments and equipment of College of Life Sciences and Oceanography in Shenzhen University.

Funding

This research was funded by the National Key R&D Program of China (2021YFC3101304), the National Natural Science Foundation of China (42376219, 41706137), Hainan International Scientific and Technological Cooperation R & D project (GHYF2024013).

Author information

Authors and Affiliations

Authors

Contributions

CS and QH Conceptualization;  LS, CL,  and PC Formal analysis and validation,  CS and QH writing—original draft preparation,  QH, MAH, and JNN writing—review and editing,  CS supervision and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Quaid Hussain.

Ethics declarations

Ethics approval and consent to participate

The experiments did not involve endangered or protected species. The data collection of plants was carried out with permission of related institution, and complied with national or international guidelines and legislation.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Shang, C., Sihui, L., Li, C. et al. SOS1 gene family in mangrove (Kandelia obovata): Genome-wide identification, characterization, and expression analyses under salt and copper stress. BMC Plant Biol 24, 805 (2024). https://doi.org/10.1186/s12870-024-05528-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12870-024-05528-0

Keywords