Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

Dynamic characteristics and functional analysis provide new insights into the role of GauERF105 for resistance against Verticillium dahliae in cotton

BMC Plant Biology volume 23, Article number: 501 (2023) Cite this article

Abstract

Background

The cotton industry suffers significant yield losses annually due to Verticillium wilt, which is considered the most destructive disease affecting the crop. However, the precise mechanisms behind this disease in cotton remain largely unexplored.

Methods

Our approach involved utilizing transcriptome data from G. australe which was exposed to Verticillium dahliae infection. From this data, we identified ethylene-responsive factors and further investigated their potential role in resistance through functional validations via Virus-induced gene silencing (VIGS) in cotton and overexpression in Arabidopsis.

Results

A total of 23 ethylene response factors (ERFs) were identified and their expression was analyzed at different time intervals (24 h, 48 h, and 72 h post-inoculation). Among them, GauERF105 was selected based on qRT-PCR expression analysis for further investigation. To demonstrate the significance of GauERF105, VIGS was utilized, revealing that suppressing GauERF105 leads to more severe infections in cotton plants compared to the wild-type. Additionally, the silenced plants exhibited reduced lignin deposition in the stems compared to the WT plants, indicating that the silencing of GauERF105 also impacts lignin content. The overexpression of GauERF105 in Arabidopsis confirmed its pivotal role in conferring resistance against Verticillium dahliae infection. Our results suggest that WT possesses higher levels of the oxidative stress markers MDA and H2O2 as compared to the overexpressed lines. In contrast, the activities of the antioxidant enzymes SOD and POD were higher in the overexpressed lines compared to the WT. Furthermore, DAB and trypan staining of the overexpressed lines suggested a greater impact of the disease in the wild-type compared to the transgenic lines.

Conclusions

Our findings provide confirmation that GauERF105 is a crucial candidate in the defense mechanism of cotton against Verticillium dahliae invasion, and plays a pivotal role in this process. These results have the potential to facilitate the development of germplasm resistance in cotton.

Background

Cotton is an economic crop, while Verticillium wilts severely restrict cotton production [1]. Cotton (Gossypium spp.; tribe Gossypieae, family Malvaceae) has a high economic value and wide geographical distribution. There are a total of 53 species of cotton [2], of which 46 diploid cotton species are divided into 8 genome groups of A, B, C, D, E, F, G, and K. The remaining 7 tetraploid cotton species (AD)1-(AD)7 belong to one allopolyploid genome [3,4,5]. The A, B, E, and F cotton-type genomes are distributed in Asia and Africa, the C, G, and K cotton-type genomes are distributed in Australia, and the D and AD cotton-type genomes are distributed in America.

Cotton Verticillium wilt is caused by the pathogen Verticillium dahliae, which can be further classified into Verticillium dahliae and Verticillium albo-atrum. Verticillium dahliae can cause the wilt of a variety of plants. Verticillium dahliae can infect the vascular bundles of the cotton plant. Verticillium wilt was first discovered in the United States in 1915, then introduced to China in 1935, and successively broke out in major cotton production areas [6]. In addition to cotton, fruits, and vegetables such as potatoes, tomatoes, grapes, and some woody plants can be attacked by Verticillium dahliae [7]. The main hosts of Verticillium black and white are alfalfa, hops, soybeans, tomatoes, potatoes, and some weeds [8, 9]. After investigations, the diseases in cotton fields in China are mainly caused by Verticillium dahliae [10].

Cotton Verticillium wilt is one of the soil-borne fungal vascular diseases, which leads to yearly yield losses of over 30% and a severe economic loss of roughly 250–310 million dollars for China [11]. Though, it is hard to control pathogenic harm to cotton plants, even though many attempts have been made, among them are the use of fungicides as well as cultural methods [12, 13]. Generally, to protect plants from pathogenic damage, disease-resistant cultivars must be widely planted. Although certain genes were characterized in cotton plant protection against pathogens, several effective candidate genes were updated for their use in disease-resistant breeding [11, 14, 15]. Thus, molecular mechanisms of plant resistance against Verticillium dahliae as well as the functional analysis of genes linked to defense must be explored deeply.

Among the signal pathways that plants respond to biological stress, the ethylene signaling pathway plays an important role, and many disease-resistant genes are induced and regulated by this signal pathway [16]. Overexpression of AtERF1 directly activates the expression of plant defensins (PDF1.2) and improves plant resistance to pathogens [17, 18]. The T-DNA insertion mutant of AtERF14 increases the susceptibility of Arabidopsis to Fusarium oxysporum infection [19]. AtERF96 positively regulates the resistance of Arabidopsis to necrotic pathogens by enhancing the expression of PDF1.2a, PR-3, PR-4, and ORA59 [20]. The overexpression of GmERF5 in soybean increases its resistance to Phytophthora sojae, and it can positively regulate the expression of PR genes after being induced by Phytophthora sojae [21]. Overexpression of ZmERF105 can increase the resistance of maize to S. sphaerocephala, while the erf105 mutant strain showed the opposite phenotype; after ZmERF105 overexpression strains were infected with S. sphalacca, ZmPR1a, ZmPR2, ZmPR5, ZmPR10.1. The expression of disease-related genes such as ZmPR10.2 is enhanced, on the contrary, the expression of the PR gene is reduced in the ERF105 mutant line [22]. Two ERF transcription factor members EREB1 and EREB2 from sea island cotton were cloned, and Verticillium dahliae can induce the expression of these two genes [23]. SSH method to enrich some differentially expressed genes related to a defense response and cloned the gene GbERF1-like from sea island cotton [24]. The study showed that the overexpression of GbERF1-like activated the synthesis of lignin-related genes, and enhanced cotton and pseudo-resistance of Arabidopsis to Verticillium wilt.

In this study, the GauERF105 gene was cloned and characterized from Gossypium australe. Subsequently, the functional role of this gene was elucidated in cotton through Virus-induced gene silencing (VIGS) and overexpression experiments conducted in Arabidopsis, focusing on its response to the pathogenic challenge posed by Verticillium dahliae. Our study enhances the understanding of the molecular mechanisms governing cotton's resistance to Verticillium wilt and might help to discover new disease-resistance genes in wild cotton species. Additionally, this work identifies new genetic resources that can be utilized in cotton breeding programs to improve disease resistance.

Results

Cloning and sequence analysis of GauERF105

By utilizing RNA-seq data previously published [25] for G. australe treated with Verticillium dahliae, we have successfully identified all of the ERF family genes. GauERF105 was chosen for further analysis based on its high level of expression in response to attack by Verticillium dahliae, surpassing all other selected ERF genes (Fig. 1A). The CDS sequence of GauERF105 consisting of 639 bp was successfully cloned from the G. australe. This gene encodes 213 amino acids with a theoretical molecular mass of 23.609kD and an isoelectric point of 8.99. GauERF105 was found to be located on chromosome 12 (10,153,228–10153866).

Fig. 1
figure 1

Expression and sequence analysis of GauERF105 A FPKM-based expression patterns of selected ERF genes. The red color represents the higher expressions in the heatmap. B Multiple sequence alignment of GauERF105 in different plant species

Full size image

Blastp search on NCBI and phylogenetic analysis revealed that GauERF105 has a similarity to Gossypium raimondii (XP_01243908.1), Gossypium arboretum (XP_017636134.1), Gossypium hirsutum (XP_016721164.1), Theobroma cacao (XP_017873866.1), Herrania umbratical (XP_021286001.1), Hibiscus syriacus (XP_039051919.1) and Arabidopsis thaliana (AT5G51190), and the AP2/ERF domain contains conserved YRG and RAYD elements, which may play a key role in DNA binding and protein interactions (Fig. 2A). Using the CDD website [26] to predict the conserved domain of GauERF105, the results show that the amino acid sequence contains a typical AP2 domain at positions 58-125aa (Fig. 2B).

Fig. 2
figure 2

Conserved domain and phylogenetic analysis A Prediction of the conserved domain for GauERF105, B Phylogenetic analysis of GauERF105

Full size image

Expression analysis of GauERF105 under Verticillium dahliae stress

To confirm the involvement of GauERF105 in the response to Verticillium dahliae, the expression patterns of this gene were analyzed in Gossypium australe leaves at 0 h, 3 h, 6 h, 12 h, and 24 h after fungal inoculation. It was observed that after inoculation, the expression level of GauERF105 gradually increased from 0 to 24 h post-inoculation (Fig. 3). The highest gene expression was observed at 24 h post-inoculation. The results showed that GauERF105 might be the key candidate involved in resistance against Verticillium dahliae infection.

Fig. 3
figure 3

Expression pattern of GauERF105 via RT-qPCR at 0, 3, 6, 12, and 24 h post-Verticillium dahliae inoculation

Full size image

Overexpression of GauERF105 enhances the resistance of Arabidopsis in response to Verticillium wilt attack

To experimentally validate the involvement of GauERF105 in the resistance to Verticillium wilt, we generated an overexpression vector, denoted as “PBI121-GauERF105”, and performed a transformation to introduce it into Arabidopsis thaliana. Positive seedlings were selected for screening on the MS solid medium containing kanamycin until the T3 generation where homozygous lines were screened. Samples from eleven positive T3 generation plants were collected to analyze the expression levels of GauERF105. Based on the results of RT-qPCR and agarose gel electrophoresis, we selected OE-1 and OE-2 for subsequent experiments (Fig. 4A).

Fig. 4
figure 4

Overexpression of GauERF105 enhances the resistance of Arabidopsis in response to Verticillium wilt attack. A Relative expression of GauERF105 in the overexpressed lines, B Disease index in WT and overexpressed lines after fungal inoculation, C Extent of leaf chlorosis in wildtype and overexpressed lines after fungal inoculation, D Relative amount of fungal DNA in wildtype and overexpressed lines after fungal inoculation, E Impact of Verticillium dahliae infection of WT and overexpressed lines, F MDA content (a marker of oxidative damage) in wildtype and overexpressed lines after fungal inoculation, G H2O2 content (an indicator of oxidative stress) in wildtype and overexpressed lines after fungal inoculation, H SOD activity (a measure of antioxidant capacity) in wildtype and overexpressed lines after fungal inoculation, I POD activity (a measure of antioxidant capacity) in wildtype and overexpressed lines after fungal inoculation

Full size image

An experiment was conducted to evaluate the effects of introducing the overexpression vector “PBI121-GauERF105” into Arabidopsis thaliana on resistance to Verticillium dahliae. Seeds from the OE-1 and OE-2 lines were spot-planted onto MS medium supplemented with a small amount of the pathogen, and the growth and development of the resulting plants were observed. Results indicated that WT showed a more sensitive phenotype to Verticillium dahliae as compared to the transgenic lines “OE-1 and OE-2”. In addition, the degree of WT plants' resistance towards Verticillium wilt was lower than that of transgenic lines, which indicates that the overexpression of the GauERF105 gene enhances the plant's resistance to Verticillium dahliae infection. We also planted wild-type Arabidopsis and transgenic lines in nutrient soil and observed the symptoms after inoculation. After overexpressing the GauERF105 gene in Arabidopsis, the plant's ability to resist Verticillium wilt was significantly enhanced, which is consistent with the phenotype of Arabidopsis grown on MS plates. The disease index was further counted by using the formula already mentioned in the methodology section, we observed results were consistent with that of phenotypic observations (Fig. 4B). The extent of leaf chlorosis was observed higher in overexpressed lines as compared to WT (Fig. 4C). Wildtype and overexpressed Arabidopsis seedlings were grown in MS media and were inoculated with V. dahliae to quantify the fungal DNA and impact of disease severity, results showed that WT plants were affected more as compared to overexpressed lines (Fig. 4D-E).

Measurement of oxidative stress markers and antioxidant enzyme activities

Quantification of oxidative stress markers and antioxidant activities are crucial for estimating a plant's response to biotic and abiotic stresses. Leaf samples were collected at different time intervals (0 h, 24 h, 48 h and 72 h) post-fungal inoculation. In our study, we measured both the accumulation of oxidative stress markers and the activities of antioxidant enzymes in order to evaluate oxidative stress levels and antioxidant capacity in the wild-type and overexpression plants in response to Verticillium dahliae infection. Specifically, we quantified the content of malondialdehyde (MDA) as a marker of oxidative damage to lipids and overall oxidative stress, the content of hydrogen peroxide (H2O2) as an indication of oxidative stress levels, and the activity of peroxidase (POD) and superoxide dismutase (SOD) to assess the antioxidant capacity of wild type and mutant plants [27, 28]. Herein, our results suggest that WT possesses higher levels of the oxidative stress markers MDA and H2O2 as compared to the overexpressed lines (Fig. 4F-G). In contrast, the activities of the antioxidant enzymes SOD and POD were higher in the overexpressed lines compared to the WT (Fig. 4H-I). These results suggest that the overexpression of GauERF105 might play a role in coping with V. dahliae infection by reducing the oxidative damage due to ROS, thus making the plants more resistant to Verticillium wilt.

DAB and trypan blue staining

Accumulation of reactive oxygen species (ROS) is an indication of oxidative damage caused by the stress of Verticillium dahliae infection. Following 72 h of inoculation, leaves were collected for DAB staining (Fig. 5A) to assess the level of ROS accumulation. Wild-type Arabidopsis and transgenic lines both started to accumulate ROS but the leaves of WT plants are affected more as compared to transgenic lines, indicating that the overexpression of GauERF105 reduced the damage caused by Verticillium dahliae infection.

In response to Verticillium dahliae infection, the plants experienced significant damage leading to the production of a substantial number of dead cells. Therefore, the wild-type plants are stained darker. At the same time, the staining area of the wild-type Arabidopsis thaliana after inoculation was significantly larger than that of the transgenic Arabidopsis thaliana, which indicated that the damage of Verticillium dahliae to plants was greatly reduced after the GauERF105 gene was overexpressed (Fig. 5B).

Fig. 5
figure 5

DAB and trypan blue staining A DAB staining to estimate the damage on Arabidopsis leaves after fungal inoculation, B DAB staining to estimate the damage on Arabidopsis leaves after fungal inoculation

Full size image

Silencing of the GauERF105 gene decreases the resistance against Verticillium dahliae in cotton

To establish the functional role of GauERF105 in the response of cotton to Verticillium dahliae infection, we employed a technique known as virus-induced gene silencing (VIGS) to specifically downregulate the expression of GauERF105 (Fig. 6). About 13 days after VIGS, the cotton leaves were injected with TRV: PDS bacteria, chlorosis started and an albino phenotype was observed, which proved that the VIGS system was established successfully and the results were accurate for the further experiment (Fig. 6A). The qRT-PCR results showed that the expression level of the GauERF105 gene was significantly lower in silenced plants as compared to WT and TRV:00, indicating that the GauERF105 gene is accurately silent .

Fig. 6
figure 6

Silencing GauERF105 decreases resistance against Verticillium dahliae in cotton A Representative images of WT, positive control, and VIGS plants, B Relative expression of GauERF105 in WT, TRV:00, and TRV:GauERF105, C Disease index (%) in WT, TRV:00, and TRV:GauERF105, D Relative amount of fungal DNA in WT, TRV:00, and TRV:GauERF105, E Histochemical staining of cotton stem lignin. Bars show standard error. WT: Wild type, TRV:00: Positive control, TRV:GauERF105, the gene silenced plants

Full size image

Further, wild-type plants, empty vector plants, and silent plants were inoculated with Verticillium dahliae, and the phenotype was observed after 25 days of inoculation (Fig. 6B). Compared with the control plants, the leaves of the silent plants turned yellow, wilted and even fell off, and the disease index of the silent plants was also significantly higher. The degree of infection in silent plants was severe as compared to control plants (Fig. 6C). In addition, the leaves of WT, TRV:00, and TRV: GauERF105 plants were quantified for Verticillium dahliae. The expression level of Verticillium dahliae in the silenced target gene plants was significantly higher than that of the control plants, which was consistent with the results of the previous disease and disease index investigation (Fig. 6D). We sterilized the cotton stems after inoculation and cultured them in a PDA solid medium. The infection rate of Verticillium dahliae in the TRV:00 plants was significantly lower than that of the TRV: ERF105 plant. This indicates that silencing of the GauERF105 gene weakens the plant's resistance to Verticillium dahliae infection and makes the plant more vulnerable to damage. Cotton lignin dying results showed that silent plants have inhibition of lignin as compared to wild-type and non-silent plants (Fig. 6E). Thus, proving the role of GauERF105 in Verticillium wilt resistance in cotton.

Expression of disease-resistant marker genes in cotton

In order to gain further insight into the regulatory role of the GauERF105 gene in the plant disease resistance process, we conducted additional screening to assess the expression of several genes related to disease-resistant pathways in both Arabidopsis and cotton (Fig. 7A, B, C). The results showed that when the plants were inoculated with Verticillium dahliae, the expression of PRs increased; the expression of AtPDF1.2, AtPR3, and AtPR4 genes in the two GauERF105 gene-transformed transgene lines OE-1 and OE-2 lines was significantly higher than that in the wildtype. In VIGS plants, the expression of PRs genes in the silenced plants was significantly downregulated. It further illustrates that the GauERF105 gene can activate hormone-related pathways to participate in plant disease resistance (Fig. 7D, E, F).

Fig. 7
figure 7

Expression analysis of disease resistance genes in transgenic Arabidopsis overexpressing GauERF105 and cotton with GauERF105 silenced via VIGS

Full size image

Discussion

Following pathogen invasion, plants typically initiate a series of defense mechanisms as a means of protection. As one of the largest transcription factor families in plants, ERFs participate in the regulation of plant disease resistance.

ERF transcription factors are key regulators of plant defense mechanisms, activating the expression of genes related to resistance to pathogens and regulating the accumulation of secondary metabolites. These mechanisms enhance the plant's natural resistance to pests and diseases [29]. In the interaction network of plant immune response, SA and JA/ET have cross-effects [24]. Studies have shown that the SA pathway is involved in regulating the defense of plants against living vegetative pathogens, and JA and ET signal transduction are considered to be effective against pathogen attacks. Necrotrophic pathogens such as B. cinerea and F. oxysporum are more effective [30]. In this study, the GauERF105 gene was screened and cloned from G. australe. Here we overexpressed GauERF105 in Arabidopsis and checked the expression levels of AtPR3, AtPR4, and AtPDF1.2 genes in the transgenic lines OE-1 and OE-2. We observed that the expressions were significantly higher in transgene lines as compared to wild-type Arabidopsis, which shows that when the expression level of the GauERF105 gene increases, the expression level of its downstream genes also increases; DAB staining results show that the staining degree of GauERF105 in transgenic Arabidopsis leaves is lighter than that of wild-type Arabidopsis. This result shows that overexpression of the GauERF105 gene reduces the oxidative damage of pathogens to plants and improves the resistance of Arabidopsis against Verticillium wilt. PR1 and PR5 are the downstream genes of the SA pathway, and PR3 and PR4 are the downstream genes of the ET/JA pathway. The promoter regions of these disease-related proteins have GCC-box. ERF transcription factors activate the expression of downstream defense genes by binding to GCC-box. So, as to enhance the plant's resistance to diseases and insect attacks. After overexpression of the potato StERF94 transcription factor, the expression of PRs-related genes increased, thereby enhancing the potato's resistance to Fusarium oxysporum [31]. Overexpression of VqERF112, VqERF114, and VqERF072 genes in Arabidopsis activated the SA signal-related genes AtNPR1 and AtPR1 and JA/ET signal-related genes AtPDF1.2, AtLOX3, AtPR3, and AtPR4, thereby enhancing the expression of Arabidopsis resistance to Pst-DC3000 and B. cinerea [32].

In addition to the disease resistance phenotypes we observed, our biochemical analyses provided insights into the potential mechanisms by which GauERF105 overexpression enhances tolerance to Verticillium dahliae. We quantified the accumulation of oxidative stress markers like malondialdehyde (MDA) and hydrogen peroxide (H2O2), as well as the activities of antioxidant enzymes like superoxide dismutase (SOD) and peroxidase (POD). The overexpression lines showed lower MDA and H2O2 levels along with higher SOD and POD activities compared to wild-type plants, indicating that they experienced less oxidative damage and more robust antioxidant defenses during infection. These results suggest that GauERF105 boosts resistance by modulating the plant's redox homeostasis and mitigating oxidative stress triggered by V. dahliae. The ability to scavenge ROS and prevent oxidative damage is crucial for plant defense against necrotrophic pathogens like V. dahliae. Our findings are in line with previous studies demonstrating the importance of antioxidant defenses in governing cotton's interaction with V. dahliae [33, 34]. The upregulation of antioxidant systems, controlled in part by defense-associated transcription factors like ERFs, is likely a key component of the enhanced tolerance we observed in the GauERF105 overexpression lines. Our work provides evidence that GauERF105 confers resistance by coordinating plant antioxidant defenses to counteract Verticillium-induced oxidative stress [25, 35]. The role of GauERF105 in the response to Verticillium dahliae was verified using VIGS. The silent plants turned yellow, wilted, or even died, compared with the control plants. After silencing the GauERF105 gene, plants are more sensitive to Verticillium wilt. Cotton disease index survey, lignin staining, Verticillium dahliae recovery culture, and quantitative experiment of Verticillium dahliae showed that the silencing of the GauERF105 gene weakens the defense ability of plants against pathogens. Compared with the control, the expressions of GhPR3, GhPR4, and GhPR5 were significantly downregulated in the silent plants, which indicated that when the expression of the GhERF105 gene interfered, the expression of its downstream genes was inhibited, which weakened the plant’s disease resistance. Compared with non-inoculated plants, the expression levels of disease-related protein genes in cotton or Arabidopsis thaliana were increased, indicating that the plants activated SA, ET/JA, and other hormone transmission pathways after being subjected to biological stress to participate in the defense response of plants.

Based on these findings, it can be concluded that GauERF105 functions as a positive regulator of Verticillium wilt resistance in both Arabidopsis and cotton. Overall, our findings provide further evidence of the importance of ERF transcription factors such as GauERF105 in conferring resistance to fungal pathogens and may have implications for the development of novel strategies for enhancing crop productivity and disease resistance in agriculture.

Conclusions

The severe impact of Verticillium dahliae infection on cotton crops in China has resulted in increasing yield losses each year, highlighting the urgent need for disease-resistant cotton varieties. Identifying candidate genes responsible for disease resistance, particularly against Verticillium dahliae in cotton, is crucial for developing such varieties. In this study, we selected and screened the GauERF105 gene from Gossypium Australe to investigate its potential role in protecting against Verticillium dahliae infection in both cotton and Arabidopsis. Overexpression experiments in Arabidopsis and VIGS in cotton demonstrated that GauERF105 acts as a positive regulator of disease resistance. Further validation through RT-qPCR, Trypan blue, DAB, and lignin staining confirmed the crucial role of GauERF105 in enhancing resistance against Verticillium dahliae infection in cotton. Our findings suggest that GauERF105 could be utilized in future breeding programs aimed at developing disease-resistant cotton varieties.

Methods

Plant material, Verticillium dahliae strains, and gene selection

The Cotton Research Institute of the Chinese Academy of Agricultural Sciences, Anyang, China, supplied the diploid wild cotton (G. australe) and the Colombian ecotype Arabidopsis used in this study. The cotton seedlings are grown in a growth box with a light/dark cycle of 16/8 h and a temperature of 27 °C (day)/23 °C (night). The wild-type Arabidopsis thaliana (COL-0) was cultured under a light/dark cycle of 16/8 h at a constant temperature of 22 °C. The highly invasive strain of V. dahliae (LX2-1) was used for disease resistance identification, and the preparation of conidia suspension (107 conidia mL−1 for cotton, 106 and 103 conidia for Arabidopsis) [25]. From previously available RNA-Seq data [25, 36], we performed a transcriptome-wide search to select all the ERF family genes in Gossypium australe, and then based on higher expressions in response to Verticillium dahliae infection we selected GauERF105 for further experiments.

Gene cloning and phylogenetic analysis

The RNA samples were extracted using the RNAprep Pure Plant Plus Kit (TIANGEN BIOTECH, Beijing, China), and their quality was assessed through agarose gel electrophoresis and spectrophotometry. TranScript-All-in-One First-Strand cDNA Synthesis SuperMix (TransGen, Beijing, China) reverse transcription kit was used to obtain cDNA. Primers were designed by using the CDS sequence of GauERF105. cDNA of G. australe was used as a template, and P505 high-fidelity polymerase (Vazyme, Nanjing, China) was used to amplify the target gene. Amino acid sequences of other cotton ERF members from the NCBI website were downloaded. DNAMAN software was used for multiple sequence alignment, and MEGA-X was used to construct a phylogenetic tree.

Generation of transgenic Arabidopsis lines

The GauERF105 gene was linked with 'BamHI' and 'SacI' restriction sites using the homologous recombination method. This resulted in the creation of an expression vector named PBI121-GauERF105. Agrobacterium tumefaciens GV3101 was transformed with this vector. Transgenic Arabidopsis thaliana plants were obtained using the flower soaking method [37]. The transgenic lines (T0, T1, and T2 seeds) were screened on half-strength Murashige and Skoog medium with kanamycin added. The T3 transgenic lines were evaluated and the expression was checked by qRT-PCR and then used in subsequent experiments. The 20-day-old Arabidopsis plants were inoculated with V. dahliae. Twenty days after inoculation (20Dpi), the symptoms were scored. According to the degree of leaf yellowing, the degree of resistance to VW is graded from 0 to 4. The calculation method of the disease index was kept the same as above.

Histochemical staining of cotton stem lignin

Cotton samples were subjected to lignin histochemical staining using the Wiesner method [38]. The parts of cotton cotyledon nodes of wild-type, TRV: 00 and TRV: GhERF105 plants were sectioned by hand. Wiesner reagent [3% (w/v) phloroglucinol in dd solution, solubilized with absolute ethanol] was used to dip the slices for 5 min and wash twice with distilled water. Then, acidify with 6% hydrochloric acid solution for 5 min, and wash away residual after hydrochloric acid treatment. Place the slices on a glass slide to observe and take pictures under a stereo microscope.

Measurement of antioxidants and oxidants enzyme activities

To evaluate oxidative stress and antioxidant activity, hydrogen peroxide (H2O2) content was measured using the YX-W-A400 assay kit (Sino Best Biological Technology Co., Ltd). Malondialdehyde (MDA) content was measured as a marker of oxidative damage, following established protocols [39, 40]. Key antioxidant enzymes peroxidase (POD) and superoxide dismutase (SOD) were assayed based on previously described methods [41, 42] to provide insights into antioxidant capacity.

Fungal recovery assay of cotton stems after V. dahliae inoculation

The fungal recovery assay was conducted according to the previously described protocol by [43]. We randomly took cotton plants treated with Verticillium dahliae. Stem sections were used that were above the cotyledons, placed in a sterilized triangular flask, and then use disinfectant to disinfect the surface of the cotton stems for 7 min. Stem sections were then sterilized immediately after disinfection with Sodium hypochlorite. Stem sections were washed with ddH2O and rinsed 3 times for 5 min. Samples were placed in a petri dish containing PDA with cephalosporin and incubated at 25 °C in the dark for 3–5 days to observe the fungal growth.

DAB staining

Hydrogen peroxide production and accumulation in the leaves were measured using the 3,3'diaminobiphenyl (DAB) staining method, which was described by [44]. After 72 h of inoculation with Verticillium dahliae, Arabidopsis leaves were taken, rinsed with distilled water, and then dried with filter paper. Leaves were added in a 2 mL centrifuge tube, and then an appropriate amount of DAB staining solution for staining, and then placed in the dark at room temperature for 8 h. After 8 h the staining solution was removed and then 95% ethanol was added to remove chlorophyll repeat this step 3 times., Sterilized water was then used to wash the leaves before taking pictures.

Trypan blue staining

The leaves of Arabidopsis plants transformed with GauERF105 and the wild-type Arabidopsis control group were inoculated for 72 h and then soaked in a solution of trypan blue dye (10 mL lactic acid, 10 mL glycerin, 10 g phenol, 10 mg trypan blue, and 10 mL distilled water). The samples were then subjected to a boiling water bath for 2 min, followed by cooling and decolorization in chloral hydrate (2.5 g/mL). The decolorizing solution was changed every day for 3 days, and the samples were washed with sterilized water before being photographed.

Cotton VIGS and quantification of disease resistance

The VIGS procedure used in this study was based on previously described protocols by [25]. A 432 bp GauERF105 fragment was amplified and inserted between the BamHI and EcoRI sites of the tobacco Rattle virus (TRV) binary vector pTRV2. The phytoene desaturase (PDS) gene was used as a marker to detect the reliability of silencing. Verticillium dahliae was inoculated 21 days after the silencing. These experiments were repeated three times independently, using more than 35 plants for each treatment. At 25dpi, the seedling's symptoms are divided into five levels: 0, 1, 2, 3, and 4 according to the symptoms on the leaves [45]. The calculation of the Disease index (DI) was as follows [36]:

$$\mathbf{D}\mathbf{I}=[(\sum \mathbf{d}\mathbf{i}\mathbf{s}\mathbf{e}\mathbf{a}\mathbf{s}\mathbf{e}\,\mathbf{g}\mathbf{r}\mathbf{a}\mathbf{d}\mathbf{e}\mathbf{s}\times \mathbf{n}\mathbf{u}\mathbf{m}\mathbf{b}\mathbf{e}\mathbf{r}\,\mathbf{o}\mathbf{f}\,\mathbf{i}\mathbf{n}\mathbf{f}\mathbf{e}\mathbf{c}\mathbf{t}\mathbf{e}\mathbf{d}\,\mathbf{p}\mathbf{l}\mathbf{a}\mathbf{n}\mathbf{t}\mathbf{s})/(\mathbf{t}\mathbf{o}\mathbf{t}\mathbf{a}\mathbf{l}\,\mathbf{n}\mathbf{u}\mathbf{m}\mathbf{b}\mathbf{e}\mathbf{r}\,\mathbf{o}\mathbf{f}\,\mathbf{s}\mathbf{c}\mathbf{o}\mathbf{r}\mathbf{e}\mathbf{d}\,\mathbf{p}\mathbf{l}\mathbf{a}\mathbf{n}\mathbf{t}\mathbf{s}\times 4)]\times 100.$$

Expression analysis of defense marker genes

Leaf tissues of cotton and Arabidopsis thaliana, which were inoculated with Verticillium dahliae, were collected at 48 and 72 h post-infection, respectively. Total RNA was extracted from the frozen tissues using liquid nitrogen. The expression levels of defense marker genes in cotton and Arabidopsis were determined using specific primers for disease-related proteins (PRs), as previously described by [24]. The experiments were conducted with three biological replicates and three technical replicates.

Expression analysisvia qRT-PCR

Total RNA was extracted and reverse-transcribed into cDNA. For PCR amplification SYBR®qPCR Master Mix (Vazyme, Nanjing, China) was used. The cotton GhUBQ7 gene and the Arabidopsis AtActin gene were used as internal reference genes for qRT-PCR analysis. The 2−ΔΔct method was used to calculate the relative expression of genes. The qRT-PCR assays were performed as described previously [36]. For GauERF105 following promers were used “F = AGAGTGAGCCTGTTGGAGTC”, “R = TACATAACCTCAAGCCTGGAGTA”.

Availability of data and materials

Not applicable.

References

  1. Li T, Zhang Q, Jiang X, Li R, Dhar N. Cotton CC-NBS-LRR gene GbCNL130 confers resistance to Verticillium wilt across different species. Front Plant Sci. 2021;12:695691. https://www.frontiersin.org/articles/10.3389/fpls.2021.695691/full.

  2. Kunbo W, Wendel JF, Jinping H. Designations for individual genomes and chromosomes in Gossypium. J Cotton Res. 2018;1(1):1–5.

    Google Scholar 

  3. Beasley J. Meiotic chromosome behavior in species, species hybrids, haploids, and induced polyploids of Gossypium. Genetics. 1942;27(1):25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Fryxell PA. A revised taxonomic interpretation of Gossypium L. (Malvaceae). Rheedea. 1992;2(2):108–65.

    Google Scholar 

  5. Phillips LL. The cytology and phylogenetics of the diploid species of Gossypium. Am J Bot. 1966;53(4):328–35.

    Article  Google Scholar 

  6. Jian G, Lu M, Xiu J, Wang F, Zhang H. Control strategy of Verticillium dahliae in cotton. China Plant Protect. 2004;24(4):30–1.

    Google Scholar 

  7. Barbara D. Verticillium Wilts-GF Pegg and BL Brady; CABI Publishing, CAB International, Wallingford, Oxon OX10 8DE, UK & 10 East 40th Street, Suite 3203, New York, NY 10016, USA, 552 pages. ISBN 0 85199 529 2. Physiol Mol Plant Pathol. 2003;1(62):51–2.

    Article  Google Scholar 

  8. Ligoxigakis E, Vakalounakis D, Thanassoulopoulos C. Weed hosts of Verticillium dahliae in Crete: Susceptibility, symptomatology and significance. Phytoparasitica. 2002;30(5):511–8.

    Article  Google Scholar 

  9. Chen P, Lee B, Robb J. Tolerance to a non-host isolate of Verticillium dahliae in tomato. Physiol Mol Plant Pathol. 2004;64(6):283–91.

    Article  CAS  Google Scholar 

  10. Yinhua J, Xiwen W, Junling S, Zhongli Z, Zaoe P, Shoupu H, et al. Association mapping of resistance to Verticillium wilt in Gossypium hirsutum L. germplasm. Afr J Biotechnol. 2014;13(31):3165–72.

  11. Gong Q, Yang Z, Wang X, Butt HI, Chen E, He S, et al. Salicylic acid-related cotton (Gossypium arboreum) ribosomal protein GaRPL18 contributes to resistance to Verticillium dahliae. BMC Plant Biol. 2017;17(1):1–15.

  12. Mohamed HI, Akladious SA. Changes in antioxidants potential, secondary metabolites and plant hormones induced by different fungicides treatment in cotton plants. Pestic Biochem Physiol. 2017;142:117–22.

    Article  CAS  PubMed  Google Scholar 

  13. Wei Z, Yu D. Analysis of the succession of structure of the bacteria community in soil from long-term continuous cotton cropping in Xinjiang using high-throughput sequencing. Arch Microbiol. 2018;200(4):653–62.

    Article  CAS  PubMed  Google Scholar 

  14. Cai Y, Xiaohong H, Mo J, Sun Q, Yang J, Liu J. Molecular research and genetic engineering of resistance to Verticillium wilt in cotton: a review. Afr J Biotechnol. 2009;8(25). https://www.ajol.info/index.php/ajb/article/view/77743.

  15. Zeng H, Chen R, Luo X, Tian J. Isolation and anti-Verticillium dahliae activity from Bacillus axarquiensis TUBP1 protein. Process Biochem. 2016;51(10):1691–8.

    Article  CAS  Google Scholar 

  16. Yang C, Lu X, Ma B, Chen S-Y, Zhang J-S. Ethylene signaling in rice and Arabidopsis: conserved and diverged aspects. Mol Plant. 2015;8(4):495–505.

    Article  CAS  PubMed  Google Scholar 

  17. Berrocal-Lobo M, Molina A, Solano R. Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J. 2002;29(1):23–32.

    Article  CAS  PubMed  Google Scholar 

  18. Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R. ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell. 2003;15(1):165–78.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Oñate-Sánchez L, Anderson JP, Young J, Singh KB. AtERF14, a member of the ERF family of transcription factors, plays a nonredundant role in plant defense. Plant Physiol. 2007;143(1):400–9.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Catinot J, Huang JB, Huang PY, Tseng MY, Chen YL, Gu SY, Lo WS, Wang LC, Chen YR, Zimmerli L. ETHYLENE RESPONSE FACTOR 96 positively regulates A rabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate–and ethylene-responsive defence genes. Plant Cell Environ. 2015;38(12):2721–34.

    Article  CAS  PubMed  Google Scholar 

  21. Dong L, Cheng Y, Wu J, Cheng Q, Li W, Fan S, Jiang L, Xu Z, Kong F, Zhang D. Overexpression of GmERF5, a new member of the soybean EAR motif-containing ERF transcription factor, enhances resistance to Phytophthora sojae in soybean. J Exp Bot. 2015;66(9):2635–47.

    Article  CAS  PubMed  Google Scholar 

  22. Zang Z, Lv Y, Liu S, Yang W, Ci J, Ren X, Wang Z, Wu H, Ma W, Jiang L. A novel ERF transcription factor, ZmERF105, positively regulates maize resistance to Exserohilum turcicum. Front Plant Sci. 2020;11:850.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Meng X, Li F, Liu C, Zhang C, Wu Z, Chen Y. Isolation and characterization of an ERF transcription factor gene from cotton (Gossypium barbadense L.). Plant Mol Biol Report. 2010;28(1):176–83.

    Article  CAS  Google Scholar 

  24. Guo W, Jin L, Miao Y, He X, Hu Q, Guo K, Zhu L, Zhang X. An ethylene response-related factor, GbERF1-like, from Gossypium barbadense improves resistance to Verticillium dahliae via activating lignin synthesis. Plant Mol Biol. 2016;91(3):305–18.

    Article  CAS  PubMed  Google Scholar 

  25. Dong Q, Magwanga RO, Cai X, Lu P, Nyangasi Kirungu J, Zhou Z, Wang X, Wang X, Xu Y, Hou Y. RNA-sequencing, physiological and RNAi analyses provide insights into the response mechanism of the ABC-mediated resistance to Verticillium dahliae infection in cotton. Genes. 2019;10(2):110.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M. CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res. 2009;37(suppl_1):D205–10.

    Article  CAS  PubMed  Google Scholar 

  27. Song H, Yao P, Zhang S, Jia H, Yang Y, Liu L. A non-specific lipid transfer protein, NtLTPI. 38, positively mediates heat tolerance by regulating photosynthetic ability and antioxidant capacity in tobacco. Plant Physiol Biochem. 2023;200:107791.

    Article  CAS  PubMed  Google Scholar 

  28. Wang M, Ding F, Zhang S. Mutation of SlSBPASE aggravates chilling-induced oxidative stress by impairing glutathione biosynthesis and suppressing ascorbate-glutathione recycling in tomato plants. Front Plant Sci. 2020;11: 565701.

    Article  PubMed  PubMed Central  Google Scholar 

  29. WJ Shao, J Shi, P Zhang, MI Lang. Research progress of ERF transcription factors in regulating biological stress responses. Biotechnol Bull. 2021;37(3):136.

    Google Scholar 

  30. Derksen H, Rampitsch C, Daayf F. Signaling cross-talk in plant disease resistance. Plant Sci. 2013;207:79–87.

    Article  CAS  PubMed  Google Scholar 

  31. Charfeddine M, Samet M, Charfeddine S, Bouaziz D, Bouzid RG. Ectopic expression of StERF94 transcription factor in potato plants improved resistance to Fusarium solani infection. Plant Mol Biol Report. 2019;37(5):450–63.

    Article  Google Scholar 

  32. Wang L, Liu W, Wang Y. Heterologous expression of Chinese wild grapevine VqERFs in Arabidopsis thaliana enhance resistance to Pseudomonas syringae pv. tomato DC3000 and to Botrytis cinerea. Plant Science. 2020;293:110421.

    Article  CAS  PubMed  Google Scholar 

  33. Dos Santos C, Carmo LS, Távora FT, Lima RF, da Nobrega Mendes P, Labuto LB, de Sá MEL, Grossi-de-Sa MF, Mehta A. Overexpression of cotton genes GhDIR4 and GhPRXIIB in Arabidopsis thaliana improves plant resistance to root-knot nematode (Meloidogyne incognita) infection. 3 Biotech. 2022;12(9):211.

    Article  PubMed  PubMed Central  Google Scholar 

  34. Zhang M, Wang X, Yang J, Wang Z, Chen B, Zhang X, Zhang D, Sun Z, Wu J, Ke H. GhENODL6 isoforms from the phytocyanin gene family regulated verticillium wilt resistance in cotton. Int J Mol Sci. 2022;23(6):2913.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Faizan M, Hayat S, Ahmed SM. Reactive Oxygen Species: Prospects in Plant Metabolism. Singapore: Springer Nature; 2023.

  36. Cai Y, Cai X, Wang Q, Wang P, Zhang Y, Cai C, Xu Y, Wang K, Zhou Z, Wang C. Genome sequencing of the Australian wild diploid species Gossypium australe highlights disease resistance and delayed gland morphogenesis. Plant Biotechnol J. 2020;18(3):814–28.

    Article  CAS  PubMed  Google Scholar 

  37. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16(6):735–43.

    Article  CAS  PubMed  Google Scholar 

  38. Speer E. A method of retaining phloroglucinol proof of lignin. Stain Technol. 1987;62(4):279–80.

    Article  CAS  PubMed  Google Scholar 

  39. Wang C, Zhang SH, Wang PF, Li W, Lu J. Effects of ammonium on the antioxidative response in Hydrilla verticillata (Lf) Royle plants. Ecotoxicol Environ Saf. 2010;73(2):189–95.

    Article  CAS  PubMed  Google Scholar 

  40. Zhu Z, Chen Z, Li L, Shao Y. Response of dominant plant species to periodic flooding in the riparian zone of the Three Gorges Reservoir (TGR) China. Sci Total Environ. 2020;747: 141101.

    Article  CAS  PubMed  Google Scholar 

  41. Wang L, Wang Y, Wang X, Li Y, Peng F, Wang L. Regulation of POD activity by pelargonidin during vegetative growth in radish (Raphanus sativus L.). Scientia Horticulturae. 2014;174:105–11.

    Article  CAS  Google Scholar 

  42. Kosar F, Akram NA, Ashraf M, Ahmad A, Alyemeni MN, Ahmad P. Impact of exogenously applied trehalose on leaf biochemistry, achene yield and oil composition of sunflower under drought stress. Physiol Plant. 2021;172(2):317–33.

    Article  CAS  PubMed  Google Scholar 

  43. Song Y, Thomma BP. Host-induced gene silencing compromises Verticillium wilt in tomato and Arabidopsis. Mol Plant Pathol. 2018;19(1):77–89.

    Article  CAS  PubMed  Google Scholar 

  44. Gao X, Li F, Li M, Kianinejad AS, Dever JK, Wheeler TA, Li Z, He P, Shan L. Cotton Gh BAK 1 Mediates Verticillium Wilt Resistance and Cell Death. J Integr Plant Biol. 2013;55(7):586–96.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Li ZK, Chen B, Li XX, Wang JP, Zhang Y, Wang XF, Yan YY, Ke HF, Yang J, Wu JH. A newly identified cluster of glutathione S-transferase genes provides Verticillium wilt resistance in cotton. Plant J. 2019;98(2):213–27.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We are very much thankful to the Institute of Cotton Research, the Chinese Academy of Agricultural Sciences, and to our laboratory for providing the full supply and support during the experiment.

Funding

This research was funded by the National Natural Science Foundation of China (32272090, 32171994, 32072023), Central Public-interest Scientific Institution Basal Research Fund (1610162023030), Nanfan Special Project of National Nanfan Research Institute of Chinese Academy of Agriculture Sciences (YBXM2309, YBXM2324). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Author information

Author notes

  1. Yanqing Wang, Muhammad Jawad Umer and Xiaoyan Cai contributed equally to this work.

Authors and Affiliations

  1. National Key Laboratory of Cotton Bio-Breeding and Integrated Utilization/Institute of Cotton Research, Chinese Academy of Agricultural Sciences (ICR, CAAS), Anyang, Henan, 455000, China

    Yanqing Wang, Muhammad Jawad Umer, Xiaoyan Cai, Mengying Yang, Yuqing Hou, Yanchao Xu, Teame Gereziher Mehari, Jie Zheng, Yuhong Wang, Heng Wang, Zhongli Zhou & Fang Liu

  2. College of Agronomy, Hebei Agricultural University/North China Key Laboratory for Crop Germplasm Resources of Ministry of Education, Baoding, 071001, Hebei, China

    Yanqing Wang & Zhikun Li

  3. National Nanfan Research Institute of Chinese Academy of Agriculture Sciences, Sanya, 572025, China

    Xiaoyan Cai & Fang Liu

  4. School of Agricultural Sciences, Zhengzhou University, Zhengzhou, 450001, Henan, China

    Mengying Yang & Fang Liu

  5. State Key Laboratory for Biology of Plant Diseases and Insect Pest, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, 100000, China

    Raufa Batool

  6. Ethiopian Institute of Agricultural Research, Mekhoni Agricultural Research Center, P.O BOX 47, Mekhoni, Tigray, Ethiopia

    Teame Gereziher Mehari

Authors
  1. Yanqing Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Muhammad Jawad Umer
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xiaoyan Cai
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Mengying Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Yuqing Hou
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yanchao Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Raufa Batool
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Teame Gereziher Mehari
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Jie Zheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Yuhong Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Heng Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Zhikun Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Zhongli Zhou
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Fang Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

WY, MU, and CX experimented and wrote the manuscript. TM, HY, WH, and ZJ assisted in data analysis. WY, LZ, YM, XY, ZZ, and LF revised the manuscript. All authors reviewed and approved the final manuscript.

Corresponding authors

Correspondence to Zhongli Zhou or Fang Liu.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, Y., Umer, M.J., Cai, X. et al. Dynamic characteristics and functional analysis provide new insights into the role of GauERF105 for resistance against Verticillium dahliae in cotton. BMC Plant Biol 23, 501 (2023). https://doi.org/10.1186/s12870-023-04455-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12870-023-04455-w

Keywords

BMC Plant Biology

ISSN: 1471-2229

Contact us