- Research
- Open Access
- Published:
Functional analysis revealed the involvement of ZmABCB15 in resistance to rice black-streaked dwarf virus infection
BMC Plant Biology volume 22, Article number: 484 (2022)
Abstract
Background
Maize rough dwarf disease (MRDD), caused by rice black-streaked dwarf virus (RBSDV) belonging to the Fijivirus genus, seriously threatens maize production worldwide. Three susceptible varieties (Ye478, Zheng 58, and Zhengdan 958) and two resistant varieties (P138 and Chang7–2) were used in our study.
Results
A set of ATP-binding cassette subfamily B (ABCB) transporter genes were screened to evaluate their possible involvements in RBSDV resistance. In the present study, ZmABCB15, an ABCB transporter family member, was cloned and functionally identified. Expression analysis showed that ZmABCB15 was significantly induced in the resistant varieties, not in the susceptible varieties, suggesting its involvement in resistance to the RBSDV infection. ZmABCB15 gene encodes a putative polar auxin transporter containing two trans-membrane domains and two P-loop nucleotide-binding domains. Transient expression analysis indicated that ZmABCB15 is a cell membrance localized protein. Over-expression of ZmABCB15 enhanced the resistance by repressing the RBSDV replication ratio. ZmABCB15 might participate in the RBSDV resistance by affecting the homeostasis of active and inactive auxins in RBSDV infected seedlings.
Conclusions
Polar auxin transport might participate in the RBSDV resistance by affecting the distribution of endogenous auxin among tissues. Our data showed the involvement of polar auxin transport in RBSDV resistance and provided novel mechanism underlying the auxin-mediated disease control technology.
Background
Maize rough dwarf disease (MRDD) is a major cause of crop losses in the maize (Zea mays L.) cultivation areas of Europe, Asia and South America [1,2,3]. In recent decades, MRDD has become a serious threat in the Yellow and Huai River valley, a major summer corn belt in China [4]. Previous studies have revealed three pathogens that cause MRDD, including Maize rough dwarf virus (MRDV), Mal de Rio Cuarto virus (MRCV), and rice black-streaked dwarf virus (RBSDV) [5]. In China, the major causal agent was designated and confirmed to be RBSDV [6].
RBSDV, a classic member of the genus Fijivirus in the family Reoviridae, is transmitted by small brown planthopper (Laodelphax striatellus). High density of viruliferous planthopper causes the outbreak of MRDD in the RBSDV susceptible maize varieties [7]. Application of strong insecticide to control the population of planthopper is a common method to reduce MRDD [8]. Due to high pesticide residues, chemical methods are high risk and low efficiency.
To restrain the spread of MRDD in crop fields, screening and application of intrinsic host resistance genes is one of the most cost-effective and environmentally friendly approaches [9]. In China, a number of maize cultivated varieties with different resistances to RBSDV infection have been screened and used in agriculture. However, few MRDD resistance-related genes have been identified. Recently, Rad GDP dissociation inhibitor alpha was identified as a host susceptibility factor for RBSDV resistance. βγ subunit of Arabidopsis SNF1 kinase (ZmAKINβγ-1) homolog in maize and ZmAKINβγ-2, two proteins with high sequence similarities, play important roles in the defense against RBSDV infection by regulating the primary carbohydrate, metabolism [10]. By comparative genomic analysis of the resistant inbred line (X178) and susceptible line (Ye478), Zea mays Eukaryotic Initiation Factor 4E (ZmeIF4E) was considered as a candidate gene for MRDD resistance [11]. In rice, several resistance genes conferring RBSDV also were identified. For examples, editing of OseIF4G gene confers partial resistance of rice seedlings to RBSDV [12]. A rice LRR receptor-like protein and its adaptor kinase SOBIR1 were reported to be involved in immunity against RBSDV infection [13]. Rice ARGONAUTE (AGO) proteins play crucial roles in plant defense against RBSDV invasion by regulating HEXOKINASE 1 expression [14].
Auxin plays a role in triggering resistance to pathogen infection [15]. Several rice Auxin Response Factor (ARF) genes, such as OsARF11, 12 and 16, involved in antiviral immune responses against rice dwarf virus invasion [16]. Rice Auxin/indole-3-acetic Acid (Aux/IAA) 10 is a target gene of rice dwarf virus P2 protein during viral infection and disease development [17]. Tobacco mosaic virus directs the reprogramming of the Aux/IAA gene expression in the vascular phloem to enhance virus phloem loading and systemic spread [18, 19]. Auxin participates in tomato spotted wilt virus resistance by regulating the expression of the ARF8-miRNA167a module [20]. In maize, Auxin Binding Protein 1 reinforces the resistance of seedlings to sugarcane mosaic virus [21].
The roles of auxin in temporal regulation of resistance to pathogen infections have been well-studied [22]. A number of auxin transport proteins are responsible for auxin polar transport from apical meristems down towards roots and other organs [23]. The auxin transport system consists of three major families, including Auxin Resistant (AUX) 1/like AUX1 influx carriers, PIN-formed efflux carriers and ATP-binding cassette (ABC) transporters [24,25,26]. Despite an expanded family of ABC transporters, only a few ABC orthologs have been extensively characterized in maize [27].
Some ABCB transporters are induced by auxin treatment, and their loss-of-function mutants display various auxin imbalance-related phenotypes [28]. In Arabidopsis, more than twenty full-size ABCB genes have been identified and at least ABCB1, ABCB4, ABCB14, ABCB19 and ABCB21 are solidly involved in auxin transport [29]. Arabidopsis mutants abcb1 and abcb19, as well as their double mutant abcb1/abcb19, showed overlapping dwarf phenotypes and similar drastic reductions in polar auxin transport [30]. AtABCB4 functions primarily in the transport of auxin away from the root tip into the root epidermis [31]. AtABCB21 regulates the endogenous auxin levels and controls the development of cotyledons, roots and leaves [32]. Our previous study identified 65 maize auxin transporters, including 35 ZmABCB family members. The expression analysis showed that most of the ZmABCB genes were involved in responses to abiotic stresses, such as salt and drought, and cold stresses [25]. How ZmABCB family genes respond to biotic stresses, especially virus infection, was investigated in the present study. In the present study, ZmABCB15 was cloned and its function was identified. Over-expression of ZmABCB15 gene has positive effect on the inhibition of viral replication in maize seedlings. Our data showed the involvement of auxin in the resistance to RBSDV infection and uncovered the novel mechanism underlying auxin-mediated disease control technology.
Results
Evaluation of rough dwarf disease resistance of various maize varieties
The copy numbers of RBSDV were detected in leaves of all five maize varieties after inoculation with viruliferous planthoppers at different time points. The viral titers and replication rates of RBSDV in Ye478, Z58, and ZD958 are greater than P138 and Chang7–2 (Fig. 1a-e). Multiplications of the RBSDV at 20 d after removal of the viruliferous planthopper in Ye478, Z58, and ZD958 were 100.6, 85.2, and 55.9 folds higher than that at 5 d, respectively. Multiplications of the RBSDV in P138 (1.9 folds) and Chang7–2 (2.7 folds) were greatly inhibited at very a low level (Fig. 1f). The disease rate of the five varieties is provided in Additional file 1. The results confirmed that Ye478, Z58, and ZD958 are susceptible varieties and P138 and Chang7–2 are resistant varieties.
Comparison of viral titer after removal of the viruliferous planthopper in different maize varieties. The copy numbers of RBSDV in three susceptible varieties, including Ye478 (a), Z58 (b), and ZD958 (c), and in two resistant varieties, including P138 (d) and Chang7–2 (e). f Multiplication of the RBSDV in five selected varieties
Expression analysis of the ZmABCB family in various maize varieties
In order to investigate the potential roles of ZmABCB family members in response to RBSDV infection, the expression patterns of 35 ZmABCB genes in the leaves of five selected varieties were compared. Our data showed that several ZmABCB genes were significantly up-regulated by the RBSDV infection in all five selected varieties (Group I). Some other ZmABCB genes were slightly down-regulated or kept stable in all five selected varieties (Group II) (Fig. 2). Interestingly, the expression level of ZmABCB15 was significantly induced in the resistant varieties and sightly down-regulated in the susceptible varieties. The expression level of ZmABCB15 gene is positively correlated with the resistance to MRDD among the five maize lines, suggesting its involvement in the regulation of resistance to the RBSDV infection.
Expression analysis of the ABCB family genes under RBSDV infection. Five maize varieties, including three susceptible varieties (Ye478, Z58 and ZD958) and in two resistant varieties (P138 and Chang7–2). Compared with the control, four time points, 5d, 10d, 15d, and 20d, were selected to analyze the expression profiles of ZmABCB family. Expression profiles of maize ABCB family genes showed by a heatmap. Red indicated up-regulated and green indicated down-regulated during RBSDV infection. The heatmap scale ranges from − 3 to + 3 on a log2 scale
Cloning and structural analysis of ZmABCB15
Based on the genome of maize, the full-length sequence of ZmABCB15 was cloned using PCR amplification. Sequence analysis showed that ZmABCB15 encodes a putative transporter of 1197 amino acid residues with a calculated molecular weight of 130.75 kDa and a predicated isoelectric point of 5.80. Blast hits and phylogenetic analysis indicated significant similarity between ZmABCB15 and other ABCB family members from different plants, especially the sorghum protein SbBDA96 (Fig. 3a). Protein domain analysis showed two trans-membrane domains (TMs, locations in 56–342 and 691–9759, respectively) and two P-loop nucleotide-binding domains (NBDs, locations in 376–604 and 1010–1249, respectively) (Fig. 3b). The two TM domains were separated by a less conserved linker loop (Fig. 3c). Multiple sequence alignment revealed that ZmABCB15 protein was a classic ABCB family member, containing a universal structure similar to other ABCB family members from different plants (Fig. 3d).
Basic biological analysis of ZmABCB15. a Evolutionary tree analysis of ZmABCB15 with other ABCB family members from different plants. Red box indicated the position of ZmABCB15. b Protein structure analysis of ZmABCB15. Yellow boxes indicated trans-membrane domains (TMs) and blue boxes indicated P-loop NTH domains. Numbers indicated the position of each domain in the ZmABCB15 protein. c Trans-membrane structure analysis of ZmABCB15 protein. Red lines indicated “transmembrane” structure, blue lines indicated “inside” structure, and purple lines indicated “outside” structure. d Multiple sequence alignment of ZmABCB15 and other ABCB members from different plants. Yellow lines indicated TM, and blue lines indicated P-loop NTH domains
Basic biological function analysis of ZmABCB15
To determine the subcellular localization of ZmABCB15, bioinformatics analysis was performed. WoLFPSORT prediction showed that ZmABCB is an integral membrane protein. To conformed the subcellular localization of ZmABCB15, Enhanced Green Fluorescent Protein (eGFP)-ZmABCB15 fused protein was transiently expressed in tobacco epidermal cells. Our data showed that ZmABCB15 was localized to the cell membrane, consistent with the prediction that ZmABCB15 functions as an auxin transporter (Fig. 4a). In order to investigate the potential biological function of ZmABCB15 gene, the tissues-specific expression pattern of ZmABCB15 was analyzed. ZmABCB15 showed the highest expression level in the stems and the lowest expression level in the flowers (Fig. 4b).
Basic biological function analysis of ZmABCB15. a Subcellular localization of ZmABCB15 were transiently expressed in tobacco epidermis cells. Co-localization of ZmABCB15-GFP fusion protein with the plasma membrane marker pm-rb CD3–1008, a fusion protein of a red fluorescent protein with a plasma membrane-localized aquaporin. b Tissues-specific expression pattern of ZmABCB15. The expression of ZmABCB15 in four organs, including stem, root, leaf, and flower
Over-expression of ZmABCB15 in RBSDV susceptible variety
To analyze and confirm the contribution of ZmABCB15 to RBSDV resistance in maize, we used the Agrobacterium-mediated transformation technique to produce ZmABCB15 over-expression lines. Four transgenic lines of T1 generation were used to determine the copy number and expression level of ZmABCB15 gene. Our data showed that the Ov-1 and Ov-4 lines contained two insert copies, and Ov-2 and Ov-3 contained one insert copy. The relative expression level of ZmABCB15 gene was significantly up-regulated in Ov-2, Ov-3 and Ov-4 lines, and not in the Ov-1 line (Fig. 5a). Single copy lines are conducive to screening genetically stable transgenic homozygous plants and accelerating the process of gene biological breeding. Thus, the Ov-2 and Ov-3 lines were used to test disease resistance to RBSDV. No obvious phenotypic differences were observed between wide type (WT) and ZmABCB15 overexpression lines. The phenotype of WT, Ov-2, and Ov-3 under RBSDV infection is provided as Additional file 2.
Over-expression of ZmABCB15 in RBSDV susceptible variety. a The expression level of ZmABCB15 gene in different over-expression lines. Values are means ± SD of five independent replicates. Significant differences in CK and over-expression lines are indicated by “*”, P < 0.05. b Comparison of viral titer after removal of the viruliferous planthopper in Z58, Ov-3, and Ov-4
ZmABCB15 repressed the RBSDV replication ratio
To confirm the role of ZmABCB15 in RBSDV resistance, the RBSDV replication ratio was determined in the control and ZmABCB15 over-expressed lines. RBSDV was detected in leaves of the control and ZmABCB15-Ov lines after inoculation with viruliferous planthoppers. Compared with the control, the titers of virus in Ov-2 and Ov-3 lines were smaller and increased slightly after inoculation (Fig. 5b). Taking time point 5 d as control, the viral titer at 20 d increased 85 folds in the control seedlings. Taking time point 5 d as control, the viral titer at 20 d increased 68 and 69 folds at 20 d in the Ov-2 and Ov-3, respectively. Our data indicated that the viral replications in the Ov-2 and Ov-3 lines were inhibited, and Ov-2 showed stronger inhibitory effect on the viral replication than Ov-3.
Analysis of endogenous auxin contents
To analyze how RBSDV infection affects endogenous auxin transport, the 3-Indoleacetic acid (IAA) contents in control Z58 and ZmABCB15 over-expressing lines were determined. Compared with the un-infected seedlings (0 d), RBSDV infection significantly induced the free IAA contents and reduced the IAA-Asp contents in all tested maize lines, including Z58, Ov-2 and Ov-3, at the same time points (Fig. 6a and b). However, the free IAA and IAA-Asp change rates in Ov-2 and Ov-3 lines were obviously lower than that in Z58 (Fig. 6a and b). At the time points 10 d, 15 d, and 20 d, the free IAA concentration in Z58 were significantly higher than that in Ov-2 and Ov-3. Compared with the un-infected seedlings (0 d), the IAA-Glu and IAA-Ala contents remained constant after RBSDV infection (Fig. 6c and d).
Analysis of the role of ZmABCB15 in resistance to RBSDV infection. a Free IAA contents in Z58, Ov-3 and Ov-4 lines. b IAA-Asp contents in Z58, Ov-3 and Ov-4 lines. c IAA-Glu contents in Z58, Ov-3 and Ov-4 lines. d IAA-Ala contents in in Z58, Ov-3 and Ov-4 lines. Values are means ± SD of five independent replicates. Significant differences in Z58 and two over-expression lines are indicated by “*”, P < 0.05
Role of auxin polar transport inhibitor in the IAA contents
To reveal the role of polar auxin transport in the changes of endogenous IAA contents, two auxin polar transport inhibitors, N-1-naphthylphthalamic acid (NPA) and 1-naphthoxyacetic acid (1-NOA), were used to block auxin transport. Our data showed that application of NPA significantly increased the endogenous IAA contents in the leaves of both ZmABCB15 over-expression lines (Ov-2 and Ov-3) and control Z58. In detail, the IAA contents in leaves of Z58 was 197.18 ng/g, and in the leaves of Ov-2 and Ov-3 were 173.29 ng/g and 179.06 ng/g, respectively. After 7 days of NPA treatment, the content of IAA in leaves of Z58 was increased from 197.18 ng/g to 257.40 ng/g, with an increase range of 30.54%. After 7 days of NPA treatment, the IAA contents in young leaves of Ov-2 and Ov-3 were increased by 14.32 and 16.50% respectively (Fig. 7a). 1-NOA application showed a similar effect to NPA treatment on both of Z58 and ZmABCB15 over-expression lines (Fig. 7b).
Role of auxin polar transport inhibitor in the IAA content and ZmABCB15 expression. a The effect of NPA on IAA contents in Z58, Ov-2, and Ov-3 lines. b The effect of 1-NOA on IAA contents in Z58, Ov-2, and Ov-3 lines. c The effect of NPA on ZmACBC15 expression in Z58, Ov-2, and Ov-3 lines. d The effect of 1-NOA on ZmACBC15 expression in Z58, Ov-2, and Ov-3 lines
Role of auxin polar transport inhibitor in the expression of ZmABCB15
To reveal the role of auxin transport in the regulation of ZmABCB15 expression, two auxin polar transport inhibitors, NPA and 1-NOA, were used to block auxin transport. After 7 days NPA treatment, the expression level of ZmABCB15 gene was significantly down-regulated in the leaves of Z58 and only was slightly down-regulated in the Ov-2 and Ov-3 lines. In detail, the expression level of ZmABCB15 was decreased by 45.6% in Z58 and only was deceased by 12.7 and 10.2% in Ov-2 and Ov-3, respectively (Fig. 7c). 1-NOA application showed a similar effect to NPA treatment on both of Z58 and ZmABCB15 over-expression lines (Fig. 7d).
Discussion
RBSDV causes several viral diseases in maize worldwide, leading to significant losses in yield of susceptible cultivars. Auxin controls many aspects of disease symptoms, particular in virus-induced abnormal growth and development [33]. In model plants, interactions between virus replicase and Aux/IAA proteins lead to alteration in Aux/IAA localization that is required for the development of disease localization [19]. However, the molecular basis of auxin-related resistance to virus infection remains poorly understood.
In maize, MRCV infection causes auxin imbalance by altering the expression of several auxin transporter encoding genes, PIN-FORMEDs (PINs) and PIN-likes [34]. In all tested maize varieties, many ZmABCB family genes, such as ZmABCB28, ZmABCB1, ZmABCB5, ZmABCB2, ZmABCB7, ZmABCB18, ZmABCB29, ZmABCB27, ZmABCB3, ZmABCB11, and ZmABCB30, were significantly up-regulated, suggesting an activated auxin transport in RBSDV infected seedlings.
Comparing resistant and susceptible materials is an efficient method to screen MRDD resistance genes. A large number of maize materials, including several resistant lines, such as ‘80007’, ‘K36’, ‘Mo17’, ‘Zheng58’, and ‘Zhengdan958’, and several susceptible lines, such as ‘80044’, ‘S221’, ‘Ye478’, ‘XH6’, ‘P138’, ‘Chang7–2’, and ‘Dan 340, were reported by different groups, providing abundant genetic materials for screening MRDD resistance genes [5, 35, 36]. Interestingly, a resistant varieties-specific inducted auxin transporter encoding gene, ZmABCB15, was identified, suggesting a potential RBSDV resistance gene.
ABCB family transporters function in long distance auxin transport and non-polar auxin distribution in vegetative organs [37]. Homologs of ABCB family genes have been reported in both monocots and dicots. In maize, loss-of-function mutations in ZmABCB1 result in short stature plant designated as brachytic2 [38]. Here, ZmABCB15 was identified and cloned, aiding to understand auxin transport in monocots. In model plants, several auxin transport-related ABCB genes were reported to process a tissue specific expression pattern. For examples, AtABCB1 is expressed in the stele tissues of the root apical region, AtABCB4 is expressed in the root epidermis, AtABCB14 and AtABCB15 are expressed in the vascular tissues of the inflorescence stem, and AtABCB19 is expressed in the hypocotyl and root [29, 39, 40]. Expression analysis showed that ZmABCB15 was primarily expressed in the stem, suggesting a potential role in mediating root ward auxin transport.
The auxin signaling pathway consists of different components, such as TIR1/AFB proteins, Aux/IAA proteins, ARFs, and auxin transporters [41]. Several important components of the auxin signaling pathway play significant roles in the resistance of plants to virus infection [16]. Gain-of-function mutant of OsIAA10, proteins at the nexus of the auxin signaling, enhances the rice dwarf virus infection and disease development [17]. OsARF17, a member of auxin response factor family, confers the resistance to a cytorhabdovirus by directly binding to the viral proteins [42]. However, the role of auxin transporters in the resistance to viral infection is largely unknown.
RBSDV is displayed by viral replication curve, which is an important indicator of screening resistance genes [5]. Over-expression of ZmABCB15 significantly repressed the RBSDV replication ratio, suggesting a role of auxin transporter in the resistance to RBSDV infection. In the present study, we firstly reported an auxin transporter, ZmABCB15, and its role in the resistance to RBSDV infection.
The abnormal symptoms of host plants suffered bacterial and fungal diseases are related to auxin imbalance. After RBSDV infection, many physiological and biochemical changes and metabolic processes in plants affect the expression of auxin transport genes and the synthesis of endogenous hormones, resulting in dwarfing, deformity, chlorosis, shrinkage and swelling of leaves. Understanding the correlation between the expression level of auxin transporter encoding genes and the changes of hormone level in maize under RBSDV infection can guide the application of transgenic technology or external hormone in the regulation and biological control of maize rough dwarf disease.
Under normal conditions, the contents of free IAA in ZmABCB15 over-expression lines were similar to the control Z58. Addition to free IAA, the major active form of endogenous auxin, inactive IAA-Ala and two types of intermediates, including IAA-Asp and IAA-Glu, exist in plants extensively [43]. Interestingly, over-expression of ZmABCB15 alleviated the increasing of free IAA and enhanced the rising of IAA-Asp in transgenic plants compared with Z58, indicating a role of ZmABCB15 in homeostasis of active and inactive auxins in the RBSDV infected seedlings.
Our current understanding of how auxin moves between different tissues is largely built on the application of polar auxin transporter inhibitors [44]. The ability of NPA to disrupt tropic growth, but not plant growth, prompted its use as an inhibitor of polar auxin transport [45]. After NPA treatment, the auxin content was largely induced in the control Z58. The gradient distribution of auxin concentration was disordered, which affected the normal development of maize seedlings with rough dwarf disease. Auxin transporter inhibitors might affect the activity of ABCB family transporters [46]. Polar auxin transport might participate in the MRDD resistance by affecting the distribution of endogenous auxin among tissues.
Conclusions
Our findings demonstrated that ZmABCB15 encoding an auxin transporter involved in resistance to RBSDV infection. Expression analysis showed that ZmABCB15 primarily expressed in the leaves and was significantly induced by RBSDV infection in the resistant varieties. Over-expression of ZmABCB15 in RBSDV susceptible variety enhanced resistance to MRDD by repressing the RBSDV replication ratio. Over-expression of ZmABCB15 might affect the homeostasis of active and inactive auxins in the RBSDV infected seedlings. Application of auxin polar transport inhibitor affect the IAA content and ZmABCB15 expression. Our data showed the involvement of ZmABCB15 in the resistance to MRDD and provided novel mechanism underlying the auxin-mediated disease control technology.
Methods
Plant and planthopper materials
Five maize varieties, including four inbred lines (Zheng58 (Z58), Chang7–2, P138, and Ye478) and one hybrid (Zhengdan 958 (ZD958)), were used in our study. Ye478, Z58 and ZD958 are susceptible varieties and P138 and Chang7–2 are resistant varieties [5, 31]. Planthoppers (Laodelphax striatellus) were fed on wheat cv. Zhoumai 19 seedlings in a pot covered with 80-mesh mothproof net in a greenhouse. The growth condition was set with a photoperiod of 16 h light/8 h dark, relative humidity of 60%, light intensity of 120 μmol.m− 2. s− 1, and temperature at 25°C.
Virus transmission and leaf sampling
The virus-free small brown planthopper were fed on MRDD plants in Jinan for 3 d to acquire the virus. Then, the planthoppers with RBSDV were fed on two-week-old wheat seedlings for another a week at 25°C. Before inoculation, 50 planthoppers were randomly selected for PCR to evaluate to the RBSDV carrier rate. Three biological repeats (50 planthoppers each repeat) were performed. The RNA of each planthopper was extracted and amplified using two RBSDV specific primers (RP: 5′-GCTCCTACTGAGTTGCCTGTC-3′; RBSDV-R: 5′-TCAGCAAAAGGTAAGGAACG-3′). Total RNAs from a single planthopper were isolated using the ZYMO RESEARCH Direct-zol RNA MiniPrep Kit (Irvine, CA, USA) according to its method. Three technical repeats were performed in the PCR experiment.
Uninfected two-leaf-stage maize seedlings were inoculated with viruliferous planthoppers for 3 d. Each maize seedling was inoculated with 10 viruliferous planthoppers. RBSDV-free small brown planthopper inoculated maize seedlings were used as controls. After inoculation, the infected maize seedlings were sprayed with 5% 1-(6-chlorine-3 pyridine methyl)-N-nitroalkane-2-amino to kill the planthoppers. Then, five fully expanded leaves of infected maize seedling were collected on 0 d, 5 d, 10 d, 15 d, and 20 d after the removal of viruliferous planthoppers.
Treatment of the maize seedings with chemicals
1-N-naphthylphthalamic acid (NPA) and 1-naphthoxyacetic acid (1-NOA), two auxin polar transport inhibitors, were purchased from Aladdin corporation (Shanghai, China). The leaves of maize seedlings were sprayed 10 mM NPA solution or 10 mM 1-NOA solution for 7 days. Deionized H2O was used as the control. For each treatment, three biological replicates were performed.
RNA extraction and standard calibration curve preparation
Total RNAs from the leaves of maize seedlings were isolated using the same RNA extraction Kit. Then, 1 μg RNA was used for reverse transcription using a TAKARA D6110A kit (Kusatsu, Japan). The S7 fragment of RBSDV was amplified using two specific primers (RBSDV-F: 5′-AGAGCTCTTCTAGTTATTGCG-3′; RBSDV-R) and its 510 bp PCR product (S7 pigment of RBSDV) was treated as standard sample. The PCR product was inserted to the pMD18-T vector and its copy number was measured using a NanoDrop 2000. A 10-fold serial dilution of the S7 fragment of RBSDV was prepared. Fluorescence qRT-PCR was performed using two primers, RBSDV-R and RP. The standard calibration curve was calculated by plotting the logarithm of the copy number of serial dilutions of standard sample on the horizontal axis against the Ct value on the vertical axis. The method of qRT-PCR was performed according to our previous work [5]. The viral titer of maize seedlings was quantified by comparing the Ct values against the standard curve.
Quantitative RT-PCR for gene expression analysis
The total RNAs were extracted from the leaves of maize seedlings using a Plant RNeasy mini-Kit (Qiagen, Hilden, Germany) according to its instruction. The internal reference gene ZmACTIN (LOC100284092) was used as a control to calculate the relative fold differences between different treatments by comparing the cycle threshold values (2-ΔΔCt). Briefly, 1 μL of cDNA in ddH2O was add to 5 μL of 2× SYBR, 100 nM of each primer and ddH2O was then added to reach final volume 10 μL. The procedures for PCR were as follows: 95 °C for 10 min; 40 cycles of 95 °C for 15 s, 60 °C for 60 s. All the expression analysis was carried out for five biological replicates and each replicate was run in triplicate. The primer sequences are listed in Additional file 3.
Subcellular localization, phylogenetic tree building, and gene structure analysis
The full-length ZmABCB15 sequence was cloned into the pH7HWG2.0 vector to produce an artificial fused GFP protein with primers: ATGCCAGCCATCCAAGGGAA/ TTAGTCTTTGACTCCTTTGC. Two vectors, including ZmABCB15-GFP and empty-GFP, were transiently expressed in N. benthamiana epidermal cells by GV3101-mediated transformation. The fluorescence of the GFP fused protein was detected using a LSM710 confocal microscope (Carl Zeiss, Oberkochen, Germany).
Multiple sequence alignments were carried out using ClustalW software (http://www.clustal.org/clustal2/) with default parameters and visualized by GeneDoc software (http://www.nrbsc.org/gfx/genedoc/). An unrooted phylogenetic tree was constructed with ZmABCB15 and seven ABCB family members from other plants using MEGA6 (http://www.megasoftware.net/mega6/mega.html). The sequences of ZmABCB family are listed in Additional file 4. The transmembrane structures of ZmABCB15 were estimated using TMHMM2 online tool (www.cbs.dtu.dk/services/TMHMM/).
Genetic transformation of ZmABCB15 in maize
For over-expression vector construction, the full-length cDNA of ZmABCB15 from field grown B73 inbred seedlings was cloned into the pCAMBIA3301 vector with two restriction enzymes (HindIII and BamHI). Then, the construction was introduced into Agrobacterium tumefaciens strain EHA105 according to previously published work [32]. The ears of Z58 were collected from the seedlings 14 d after pollination and sterilized with 75% ethanol. Immature embryos were dissected from the sterilized ears and incubated with A. tumefaciens containing the 35S vector for 10 min. After incubation, the embryos were washed with ddH2O and transferred onto the resting medium, and selection medium. After 4 weeks of selection, calli with bialaphos resistance were transferred onto the subculture medium for regeneration [33].
Southern blotting
Genomic DNA was extracted from ZmABCB15 over-expression lines of maize using cetyltrimethylammonium bromide method. Then, 10 μg of total DNAs were digested with EcoRI. After electrophoresis in 0.7% agarose gel, DNA samples were transferred to HyBond N+ membrane overnight. The sample DNA was fixed to the membrane at 80 °C for 2 h. The probes were synthesized and labeled with Digoxigenin-11-dUTP (PCR DIG Probe Synthesis Kit, Roche). DNA gel blot hybridization was performed using DIG DNA labeling and detection kit (Roche, Basel, Switzerland). The HyBond N+ membrane was washed three times using 2 × SSC/0.1% SDS solution for 5 min at 25 °C, then for 15 min in 1 × SSC/0.1% SDS solution at 65 °C twice. The membrane was blocked for 30 min and was immersed in Anti-Digoxigenin-AP solution for 30 min. Hybridized membrane was detected in the presence of CSPD (C18H20ClNa2O7P), and the signals were detected on X-ray film.
Determination of endogenous auxin contents
The RBSDV infected maize seedlings and mock seedlings were grown in half-strength modified Hoagland solution. The leaf samples were harvested and washed three times with ddH2O. Then, the tissue samples were collected by 14, 000 g centrifugation and quickly frozen in liquid N2 until used. Three independent biological replicates (15 mg each sample) were purified after addition of 250 pg of 13C6-IAA internal standard using a ProElu C18 column (DiKMA, Beijing, China). Endogenous auxin contents were measured on FOCUS GC-DSQII system (Thermo Fisher Scientific, Austin, TX, USA).
Statistical analysis
Student’s t-test analysis between mock and infected-seedlings was performed. Experiments were repeated five biological times, and standard deviations were shown with the mean of replicates±SD.
Availability of data and materials
All the data was submitted with the manuscript. No sequencing data was used in the present study.
Abbreviations
- ABC:
-
ATP-binding cassette
- ABCB:
-
ATP-binding cassette subfamily B
- AGO:
-
ARGONAUTE
- ARF:
-
Auxin Response Factor
- eGFP:
-
Enhanced Green Fluorescent Protein
- IAA:
-
3-Indoleacetic acid
- MRCV:
-
Mal de Rio Cuarto virus
- MRDD:
-
Maize rough dwarf disease
- MRDV:
-
Maize rough dwarf virus
- NBD:
-
nucleotide-binding domain
- 1-NOA:
-
1-naphthoxyacetic acid
- NPA:
-
N-1-naphthylphthalamic acid
- RBSDV:
-
rice black-streaked dwarf virus
- TM:
-
trans-membrane
- PIN:
-
PIN-FORMED
- WT:
-
wide type
- ZmAKINβγ-1:
-
βγ subunit of Arabidopsis SNF1 kinase
- ZmeIF4E:
-
Zea mays Eukaryotic Initiation Factor 4E
References
Dovas CI, Eythymiou K, Katis NI. First report of maize rough dwarf virus (MRDV) on maize crops in Greece. Plant Pathol. 2010;53(2):238.
Bai FW, Yan J, Qu ZC, Zhang HW, Xu J, Ye MM, et al. Phylogenetic analysis reveals that a dwarfing disease on different cereal crops in China is due to rice black streaked dwarf virus (RBSDV). Virus Genes. 2002;25(2):201–6.
Arneodo JD, Guzman FA, Conci LR, Laguna IG, Truol GA. Transmission features of Mai de Río Cuarto virus in wheat by its planthopper vector Delphacodes kuscheli. Ann Appl Biol. 2015;141(2):195–200.
Fang S, Yu J, Feng J, Han C, Li D, Liu Y. Identification of rice black-streaked dwarf fijivirus in maize with rough dwarf disease in China. Arch Virol. 2001;146(1):167–70.
Xiaohua H, Tingmu C, Runqing Y, Shulei G, Mengmeng X, Caixia L, et al. A rice black-streaked dwarf virus replication curve model to evaluate maize rough dwarf disease resistance. Plant Dis. 2019;103(5):868–73.
Chen G, Wang X, Hao J, Yan J, Ding J. Genome-wide association implicates candidate genes conferring resistance to maize rough dwarf disease in maize. PLoS One. 2015;10(11):e0142001.
Lv M, Xie L, Yang J, Chen J, Zhang HM. Complete genomic sequence of maize rough dwarf virus, a Fijivirus transmitted by the small brown planthopper. Genome Announc. 2016;4(1):e01529–15.
Clemente-Orta G, Albajes R, Batuecas I, Achon MA. Planting period is the main factor for controlling maize rough dwarf disease. Sci Rep. 2021;11(1):977.
Gururani MA, Venkatesh J, Upadhyaya CP, Nookaraju A, Pandey SK, Park SW. Plant disease resistance genes: current status and future directions. Physiol Mol Plant Pathol. 2012;78:51–65.
Li M, Sun X, Di D, Zhang A, Qing L, Zhou T, et al. Maize AKINβγ proteins interact with P8 of rice black streaked dwarf virus and inhibit viral infection. Viruses. 2020;12(12):1387.
Shi L, Weng J, Liu C, Song X, Miao H, Hao Z, et al. Identification of promoter motifs regulating ZmeIF4E expression level involved in maize rough dwarf disease resistance in maize (Zea Mays L). Mol Gen Genomics. 2013;288(3–4):89–99.
Wang W, Ma S, Hu P, Ji Y, Sun F. Genome editing of rice eIF4G loci confers partial resistance to rice black-streaked dwarf virus. Viruses. 2021;13(10):2100.
Zhang H, Chen C, Li L, Tan X, Wei Z, Li Y, et al. A rice LRR receptor-like protein associates with its adaptor kinase OsSOBIR1 to mediate plant immunity against viral infection. Plant Biotechnol J. 2021;19(11):2319–32.
Wang Z, Chen D, Sun F, Guo W, Wang W, Li X, et al. ARGONAUTE 2 increases rice susceptibility to rice black-streaked dwarf virus infection by epigenetically regulating HEXOKINASE 1 expression. Mol Plant Pathol. 2021;22(9):1029–40.
Kazan K, Manners JM. Linking development to defense: auxin in plant-pathogen interactions. Trends Plant Sci. 2009;14(7):373–82.
Qin Q, Li G, Jin L, Huang Y, Wang Y, Wei C, et al. Auxin response factors (ARFs) differentially regulate rice antiviral immune response against rice dwarf virus. PLoS Pathog. 2020;16(12):e1009118.
Jin L, Qin Q, Wang Y, Pu Y, Liu L, Wen X, et al. Rice dwarf virus P2 protein hijacks auxin signaling by directly targeting the rice OsIAA10 protein, enhancing viral infection and disease development. PLoS Pathog. 2016;12(9):e1005847.
Collum TD, Padmanabhan MS, Hsieh YC, Culver JN. Tobacco mosaic virus-directed reprogramming of auxin/indole acetic acid protein transcriptional responses enhances virus phloem loading. Proc Natl Acad Sci U S A. 2016;113(19):E2740–9.
Padmanabhan MS, Kramer SR, Wang X, Culver JN. Tobacco mosaic virus replicase-auxin/indole acetic acid protein interactions: reprogramming the auxin response pathway to enhance virus infection. J Virol. 2008;82(5):2477–85.
Werghi S, Herrero FA, Fakhfakh H, Gorsane F. Auxin drives tomato spotted wilt virus (TSWV) resistance through epigenetic regulation of auxin response factor ARF8 expression in tomato. Gene. 2021;804:145905.
Leng P, Ji Q, Asp T, Frei UK, Ingvardsen CR, Xing Y, et al. Auxin binding protein 1 reinforces resistance to sugarcane mosaic virus in maize. Mol Plant. 2017;10(10):1357–60.
Tanaka H, Dhonukshe P, Brewer PB, Friml J. Spatiotemporal asymmetric auxin distribution: a means to coordinate plant development. Cell Mol Life Sci. 2006;63(23):2738–54.
Sauer M, Kleine-Vehn J. PIN-FORMED and PIN-LIKES auxin transport facilitators. Development. 2019;146(15):dev168088.
Vosolsobe S, Skokan R, Petrasek J. The evolutionary origins of auxin transport: what we know and what we need to know. J Exp Bot. 2020;71(11):3287–95.
Yue R, Tie S, Sun T, Zhang L, Yang Y, Qi J, et al. Genome-wide identification and expression profiling analysis of ZmPIN, ZmPILS, ZmLAX and ZmABCB auxin transporter gene families in maize (Zea mays L.) under various abiotic stresses. PLoS One. 2015;10(3):e0118751.
Shen C, Yue R, Bai Y, Feng R, Sun T, Wang X, et al. Identification and analysis of Medicago truncatula auxin transporter gene families uncover their roles in responses to Sinorhizobium meliloti infection. Plant Cell Physiol. 2015;56(10):1930–43.
Bailly A, Yang H, Martinoia E, Geisler M, Murphy AS. Plant lessons: exploring ABCB functionality through structural modeling. Front Plant Sci. 2011;2:108.
Noh B, Murphy AS, Spalding EP. Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell. 2001;13(11):2441–54.
Kaneda M, Schuetz M, Lin BS, Chanis C, Hamberger B, Western TL, et al. ABC transporters coordinately expressed during lignification of Arabidopsis stems include a set of ABCBs associated with auxin transport. J Exp Bot. 2011;62(6):2063–77.
Wang B, Bailly A, Zwiewka M, Henrichs S, Azzarello E, Mancuso S, et al. Arabidopsis TWISTED DWARF1 functionally interacts with auxin exporter ABCB1 on the root plasma membrane. Plant Cell. 2013;25(1):202–14.
Kubes M, Yang H, Richter GL, Cheng Y, Mlodzinska E, Wang X, et al. The Arabidopsis concentration-dependent influx/efflux transporter ABCB4 regulates cellular auxin levels in the root epidermis. Plant J. 2012;69(4):640–54.
Jenness MK, Carraro N, Pritchard CA, Murphy AS. The Arabidopsis ATP-BINDING CASSETTE transporter ABCB21 regulates auxin levels in cotyledons, the root pericycle, and leaves. Front Plant Sci. 2019;10:806.
Teale WD, Paponov IA, Palme K. Auxin in action: signalling, transport and the control of plant growth and development. Nat Rev Mol Cell Biol. 2006;7(11):847–59.
de Haro LA, Arellano SM, Novak O, Feil R, Dumon AD, Mattio MF, et al. Mal de Rio Cuarto virus infection causes hormone imbalance and sugar accumulation in wheat leaves. BMC Plant Biol. 2019;19(1):112.
Zhang W, Deng S, Zhao Y, Xu W, Liu Q, Zhang Y, et al. qMrdd2, a novel quantitative resistance locus for maize rough dwarf disease. BMC Plant Biol. 2021;21(1):307.
Li R, Song W, Wang B, Wang J, Zhang D, Zhang Q, et al. Identification of a locus conferring dominant resistance to maize rough dwarf disease in maize. Sci Rep. 2018;8(1):3248.
Hammes UZ, Murphy AS, Schwechheimer C. Auxin transporters-a biochemical view. Cold Spring Harb Perspect Biol. 2022;14:a039875.
Multani DS, Briggs SP, Chamberlin MA, Blakeslee JJ, Murphy AS, Johal GS. Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science. 2003;302(5642):81–4.
Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V, Bandyopadhyay A, et al. Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. Plant J. 2005;44(2):179–94.
Lewis DR, Miller ND, Splitt BL, Wu G, Spalding EP. Separating the roles of acropetal and basipetal auxin transport on gravitropism with mutations in two Arabidopsis multidrug resistance-like ABC transporter genes. Plant Cell. 2007;19(6):1838–50.
Peer WA. From perception to attenuation: auxin signalling and responses. Curr Opin Plant Biol. 2013;16(5):561–8.
Zhang H, Li L, He Y, Qin Q, Chen C, Wei Z, et al. Distinct modes of manipulation of rice auxin response factor OsARF17 by different plant RNA viruses for infection. Proc Natl Acad Sci U S A. 2020;117(16):9112–21.
Hayashi KI, Arai K, Aoi Y, Tanaka Y, Hira H, Guo R, et al. The main oxidative inactivation pathway of the plant hormone auxin. Nat Commun. 2021;12(1):6752.
Teale W, Palme K. Naphthylphthalamic acid and the mechanism of polar auxin transport. J Exp Bot. 2018;69(2):303–12.
Sussman MR, Goldsmith MH. The action of specific inhibitors of auxin transport on uptake of auxin and binding of N-1-naphthylphthalamic acid to a membrane site in maize coleoptiles. Planta. 1981;152(1):13–8.
Gao LW, Lyu SW, Tang J, Zhou DY, Bonnema G, Xiao D, et al. Genome-wide analysis of auxin transport genes identifies the hormone responsive patterns associated with leafy head formation in Chinese cabbage. Sci Rep. 2017;7:42229.
Acknowledgements
Not applied.
Funding
This work was funded by Key R & D project of Shandong Province (2021LZGC022) and Shandong Natural Science Foundation of China (ZR2020MC111); Supported by China Agriculture Research System of MOF and MARA (CARS-02-09). There is no role of the funding body in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.
Author information
Authors and Affiliations
Contributions
S.T., Z.M. and R.Y. made substantial contributions to conception, was involved in drafting the manuscript, and given final approval of the version to be published. R.Y., Q.S., J.D., and W.L. (Wenlan Li) made substantial contributions to acquisition of data analysis, was involved in revising the manuscript, and given final approval of the version to be published. W.L. (Wencai Li), M.Z., S.L., T.Z., and H.Z. made substantial contributions to analysis and interpretation of data. S.Z., S.T., Z.M. and R.Y. were involved in revising the manuscript, and given final approval of the version to be published. All authors reviewed the manuscript. The author(s) read and approved the final manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
Five maize varieties, including four inbred lines (Zheng58 (Z58), Chang7–2, P138, and Ye478) and one hybrid (Zhengdan 958 (ZD958)), and planthoppers (Laodelphax striatellus) were obtained from Henan Academy of Agricultural Sciences. This project uses plant materials and complies with relevant institutional, national, and international guidelines and legislation.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1: Table S1.
The disease rates of the five varieties after inoculating RBSDV.
Additional file 2: Fig. S1.
The phenotypes of WT, Ov-2 and Ov-3 lines. (a) The growing of WT, Ov-2 and Ov-3 lines under control condition. (b) The growing of WT, Ov-2 and Ov-3 lines under RBSDV infection conditions.
Additional file 3: Table S2.
The CDSs of ZmABCB family.
Additional file 4: Table S3.
The primer sequences for the qRT-PCR.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Yue, R., Sun, Q., Ding, J. et al. Functional analysis revealed the involvement of ZmABCB15 in resistance to rice black-streaked dwarf virus infection. BMC Plant Biol 22, 484 (2022). https://doi.org/10.1186/s12870-022-03861-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12870-022-03861-w
Keywords
- Virus resistance
- Biological control
- Disease resistance
- Genetics