Skip to main content

Down-expression of TaPIN1s Increases the Tiller Number and Grain Yield in Wheat



Tiller number is a factor determining panicle number and grain yield in wheat (Triticum aestivum). Auxin plays an important role in the regulation of branch production. PIN-FORMED 1 (PIN1), an auxin efflux carrier, plays a role in the regulation of tiller number in rice (Oryza sativa); however, little is known on the roles of PIN1 in wheat.


Nine homologs of TaPIN1 genes were identified in wheat, of which TaPIN1-6 genes showed higher expression in the stem apex and young leaf in wheat, and the TaPIN1-6a protein was localized in the plasma membrane. The down-expression of TaPIN1s increased the tiller number in TaPIN1-RNA interference (TaPIN1-RNAi) transgenic wheat plants, indicating that auxin might mediate the axillary bud production. By contrast, the spikelet number, grain number per panicle, and the 1000-grain weight were decreased in the TaPIN1-RNAi transgenic wheat plants compared with those in the wild type. In summary, a reduction of TaPIN1s expression increased the tiller number and grain yield per plant of wheat.


Phylogenetic analysis and protein structure of nine TaPIN1 proteins were analyzed, and subcellular localization of TaPIN1-6a was located in the plasma membrane. Knock-down expression of TaPIN1 genes increased the tiller number of transgenic wheat lines. Our study suggests that TaPIN1s is required for the regulation of grain yield in wheat.

Peer Review reports


Tiller number of wheat (Triticum aestivum) is an important agronomic trait that contributes to grain production. Plant hormones, environmental signals, and genetic factors are involved in the regulation of tiller number [1,2,3,4]. Auxin is a hormone with polar transport characteristics, and its concentration gradient establishment is necessary for plant morphogenesis. Based on previous reports, shoot branching is correlated with polar auxin transport in pea (Pisum sativum) [5] and Arabidopsis [6, 7].

PIN protein is specific to auxin transport and is a limiting factor of auxin polar transport [8,9,10]. In Arabidopsis, eight PIN proteins are identified, which possess two conserved domains formed by transmembrane helices and a conserved central hydrophilic loop [11].

The initiation and growth of lateral branches (called tillers in grasses) are important factors in determining plant architecture and yield [12,13,14]. Previous studies have demonstrated that decreased auxin transport affects branching in the monocot plants, such as rice (Oryza sativa), maize (Zea mays), and switchgrass (Panicum virgatum) [15,16,17]. Auxin maxima created by PIN1 at the meristem surface are responsible for organ initiation [18, 19]. Twelve ZmPIN genes and two PIN-like genes in maize [20] and twelve OsPIN genes in rice had been identified [21]. Transgenic plants with a reduction of OsPIN1 gene expression display an increase in tiller number and till angle, which provides a new insight into the functions of the PIN1 family in rice [21]. Maize BARREN INFLORESCENCE2 (BIF2) regulates auxin transport through direct regulation of ZmPIN1a during maize inflorescence development [22]. In severe alleles of bif2 maize mutant, ZmPIN1a and ZmPIN1b protein expression patterns and localizations are altered in the tassel and ear [20]. The bif2 mutants form a needle-like inflorescence structure and lack branches, spikelet pairs, and florets in male tassels and female ears, which is similar to the phenotype of pin1 mutant in Arabidopsis [16].

Wheat is an important food crop; however, PIN1 genes and their functions in wheat are rarely reported. In this study, we identified nine TaPIN1 genes in wheat and analyzed their expression patterns. Furthermore, we found that down-expression of TaPIN1s in wheat resulted in more tillers and grain yield of each plant. Our results suggest that TaPIN1s play important roles in the regulation of tiller number and grain yield in wheat.


Identification of TaPIN1 genes in wheat

We used AtPIN1 protein sequence as query to blastp against wheat EnsemblPlants database to identify the homologs of AtPIN1 gene in wheat. Sequence alignment revealed that wheat A, B, and D subgenomes have several homologs, including TaPIN1-6a, TaPIN1-6b1, TaPIN1-6b2, TaPIN1-6b3, TaPIN1-6b4, TaPIN1-6d, TaPIN1-7a, TaPIN1-7b, and TaPIN1-7d. Among these sequences, chromosome 6A has one copy and it was located in 543,394,469–543,397,613, chromosome 6B four copies and they were located in 593,711,770–593,714,658, chromosome 6D one copy which was located in 397,082,345–397,084,736, chromosome 7A one copy located in 148,414,887–148,418,041, chromosome 7B one copy located in 109,702,167–109,705,332, and chromosome 7D one copy located in 146,862,702–146,865,831. The sequences encoded putative products of 588, 521, 589, 595, 587, 589, 587, 586, and 586 amino acids, respectively.

Phylogenetic analysis and predicted protein structure of TaPIN1s

The dendrogram showed that the TaPIN1-6 proteins were closely related to the PIN1 proteins in Triticum dicoccoides, Aegilops tauschii, and Hordeum vulgare, whereas the TaPIN1-7 proteins were closely related to the OsPIN1a and OsPIN1c proteins (Fig. 1a). By TMHMM2 [23] ( analysis, TaPIN1 proteins harbor the transmembrane helices predicted as the trait of auxin transport carrier candidates (Fig. 1b). Consequently, each TaPIN1s had a typical structure. The distinct central hydrophilic loop of variable length separating two hydrophobic domains of about four transmembrane regions [11], which are similar to ZmPIN1s [24] and OsPIN1s proteins [25], except for TaPIN1-6b1 and TaPIN1-6b3, lacking transmembrane domains in their C-terminals. Additionally, we analyzed the exon–intron structure schematic of TaPIN1 genes. All the TaPIN1 genes contain six exons and five introns excepted TaPIN1-6b1 gene (Fig. 1c), suggested that PIN1 gene family is conservative.

Fig. 1
figure 1

Phylogenetic analysis and predicted protein structure of PIN1s. a Phylogenetic analysis of PIN1 proteins in A. tauschii (Ae), Arabidopsis thaliana (At), Brachypodium distachyon (Bd), H. vulgare (Hv), Oryza sativa (Os), Panicum miliaceum (Pm), Setaria italica (Si), Sorghum bicolor (Sb), T. aestivum (Ta), T. dicoccoides (Td), Triticum turgidum subsp. durum (Tt), Triticum urartu (Tu), and Zea mays (Zm). b Predicted protein structure of PIN1s transporters. Blue squares show the predicted transmembrane domains of proteins. c Structural schematic of TaPIN1 genes. Black line, blue squares, and yellow squares indicate intron, CDS, and UTR, respectively

Expression patterns of TaPIN1 genes and subcellular localization of TaPIN1-6a protein

Nine TaPIN1 genes were expressed, but the expression level of each gene was different (Fig. 2a). In general, TaPIN1 genes were abundant in the root and stem; the least expression level was observed in the grain. Among different TaPIN1 genes, the expression abundance of TaPIN1-6a, TaPIN1-6b2, TaPIN1-6b3, and TaPIN1-6d was generally high in each tissue, particularly in the root, stem, and spike; moreover, the expression level of TaPIN1-6a, TaPIN1-6d, TaPIN1-6b2, and TaPIN1-6b3 was from high to low. Additionally, TaPIN1-6b1 had the lowest expression level in all tissues, and TaPIN1-6b4 had lower expression level in the stem and root. TaPIN1-7a, TaPIN1-7b, and TaPIN1-7d had a high expression level in the root, high abundance in the stem and spike, and low expression level in the leaf and grain. In situ hybridization showed that six members of TaPIN1-6 genes on chromosomes 6 were strongly expressed in the stem apex, axillary bud, and young leaf in the single ridge stage (Fig. 2b).

Fig. 2
figure 2

Expression patterns of TaPIN1 genes and subcellular localization of TaPIN1-6a protein. a Normalized gene expression (TPM) analysis of the TaPIN1 genes from five different tissues. b (1) In situ hybridization analysis of the expression of TaPIN1-6 in the stem apex and young leaves of wheat. (2) The hybridization result of the sense probe. L: leaf. SAM: shoot apical meristem. AM: axillary meristem. Bars indicate 100 μm. c (1) Fluorescence signal in Arabidopsis root of 35S::TaPIN1-6a-CDS-GFP. (2) FM4-64 staining. (3) Merged

Based on expression pattern analysis of TaPIN1 genes, TaPIN1-6a gene was generally high in each tissue. To explore the subcellular localization of the TaPIN1 proteins, 35S::TaPIN1-6a-CDS-GFP fusion expression vector was constructed and infected into Arabidopsis. Strong fluorescence signals in the TaPIN1-6a-CDS-GFP transgenic plants were located on the plasma membrane in the root, thereby indicating that TaPIN1s are plasma membrane-localized proteins (Fig. 2c).

Genetic transformation of wheat and molecular identification of transgenic plants

TaPIN1-RNA interference vector (TaPIN1-RNAi) was constructed (Fig. 3a) and transformed into wheat (T. aestivum cv. CB037) by Agrobacteria-mediated genetic transformation to identify the function of TaPIN1 genes in wheat development.

Fig. 3
figure 3

Genetic transformation of wheat and molecular identification of transgenic plants. a. The structure of the TaPIN1-RNA interference vector. RB: right boundary. LB: left boundary. b. Molecular identification of transgenic plants. (1) bar gene. (2) TaPIN1 genes. L1-L8: TaPIN1-RNAi transgenic lines. NC: negative control. PC: positive control. M: 2000 bp marker. c. qRT-PCR analysis of TaPIN1 genes expression. WT: wild type. L1-L3: transgenic lines 1–3 (*P < 0.05, **P < 0.01, ***P < 0.001)

A total of 77 resistant plants were obtained, in which eight TaPIN1-RNAi-positive plants were obtained by polymerase chain reaction (PCR)-based identification. Bar (selective marker gene) and TaPIN1 genes were confirmed simultaneously in transgenic lines (Fig. 3b). Three T4 generation plants, namely, L1, L2, and L3, were selected for further analysis. Quantitative real-time PCR (qRT-PCR) showed that the expression level of TaPIN1 genes in axillary bud after gemination 20 days was significantly decreased in L1, L2, and L3 compared with that in the wild type, particularly the expression level of TaPIN1-6a (Fig. 3c).

Knock down expression of TaPIN1 genes increased the tiller number of transgenic wheat lines

Three transgenic lines, namely, L1, L2, and L3, and wild type (cv. CB037) were sown in field to observe the agronomic characters. Tiller number was analyzed at three developmental stages, that is, tillering stage (Fig. 4a), jointing stage (Fig. 4b), and mature stage (Fig. 4c). We found that the tiller number were increased significantly compared with those of the wild type in the tillering stage and jointing stage (Fig. 4d and e). These results suggest that TaPIN1s play a role in the regulation of tiller number.

Fig. 4
figure 4

Increased tiller number of TaPIN1-RNAi transgenic lines in different developmental stages. a and d. tillering stage. b and e. jointing stage. c. mature stage. WT: wild type. L1-L3: transgenic lines 1–3 (n = 15, *P < 0.05, **P < 0.01)

Increased productive tiller number and grain yield per plant in transgenic lines

The agronomic traits of the L1, L2, and L3 transgenic lines, such as plant height, productive tiller number, spikelet number per panicle, grain number per panicle, 1000-grain weight, and grain yield per plant, were evaluated after harvest. The plant height of the L1, L2, and L3 transgenic lines was decreased slightly compared with that of the wild type (Fig. 5a). The productive tiller number and grain yield per plant of three transgenic lines were increased compared with that of the wild type and reached a significant difference level (Fig. 5b and f). By contrast, spikelet number per panicle and grain number per panicle were significantly reduced compared with wild type (Fig. 5c and d). The 1000-grain weight also declined significantly in the L2 and L3 lines (Fig. 5e). Thus, a reduction expression of TaPIN1s increased the productive tiller number and grain yield per plant of wheat.

Fig. 5
figure 5

Agronomic traits of mature wheat in the TaPIN1-RNAi transgenic lines. a. plant height. b. panicle number per plant. c. spikelet number per panicle. d. grain number per panicle. e. 1000-grain weight. f. yield per plant. WT: wild type. L1-L3: transgenic lines 1–3 (n = 15, *P < 0.05, **P < 0.01)


The optimization of plant architecture is an important goal for breeders to breed high-yielding wheat cultivars. As a key regulator of plant developmental processes, auxin plays roles in regulating the production of branch by mediating the meristem [7, 26,27,28]. The rice and maize PIN1 gene family had four members, whereas the wheat PIN1 family had nine members. Phylogenetic analysis suggested that six TaPIN1-6, TdPIN1, AePIN1, and HvPIN1 proteins and three TaPIN1-7, OsPIN1a, and OsPIN1c proteins formed a group separately (Fig. 1). In addition, the TaPIN1 genes contained four copies in genome B of wheat, which might have functional redundancy and complementarity. However, the potential mechanism of multiple members of TaPIN1s and different copies of TaPIN1-6b remains to be investigated.

In maize, ZmPIN1 marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition, and ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development [29]. The high transcript levels of OsPIN1a and OsPIN1b were observed in the root, stem base, stem, leaf, and young panicle, whereas a relatively low level of OsPIN1c was observed in the leaf and young panicle of rice [25]. We found that TaPIN1-6 genes were strongly expressed in the stem apex and young leaf in the single ridge stage of wheat. The PIN1 protein belongs to a subfamily that has a “long” central hydrophilic loop and hydrophobic domain. The hydrophobic domain sequence of PIN1s, primarily in the transmembrane helices, is highly conserved, and it does not tolerate insertions or deletions [11]. Nine candidate members of the TaPIN1 proteins harbor the transmembrane regions predicated by TMHMM2 [23], and TaPIN1s has the typical structure except for TaPIN1-6b1 and TaPIN1-6b3, which do not possess the predicated transmembrane region in C-terminal (Fig. 1b). However, the transmembrane region in the hydrophobic domain is important for PIN1 function, lack of which may results in loss of function in plants. Based on previous studies, no PIN1 protein lacks the transmembrane region in maize and rice at the C-terminal; thus, the function of TaPIN1-6b1 and TaPIN1-6b3 needs to be further investigated.

Endogenous hormones affect shoot branching [3, 7, 30]. Tiller number in monocots, such as wheat and rice, is closely associated with yield. Excessive tiller in cereal crop can lead to yield reductions because tillers compete for resources, and many secondary tillers are not fertile [31]. PIN1 genes play roles in the regulation of tiller number and tiller angle in rice [21] and switchgrass [17]. In this study, we found that the down-expression of TaPIN1s significantly increased tiller number at the tillering stage, jointing stage, and mature stage in wheat. These phenotypes are similar to those of rice and switchgrass with down-expression of PIN1 [21]. In addition, we found that the down-expression of TaPIN1s reduced the spikelet number per panicle, grain number per panicle, and the 1000-grain weight, but increased the productive tiller number and grain yield per plant. Thus, TaPIN1s function in lateral bud initiation and increase the yield per plant in wheat.

It was reported that virus-induced gene silencing of the TaPIN1 genes resulted in 26% reduction in plant height [32]. Multiple sequence alignment revealed that the TaPIN1 genes in the study by Singh et al. [32] were similar to TaPIN1-7b in the phylogenetic analysis of our study (Fig. 1a). However, no obvious change in plant height was observed in the TaPIN1-RNAi transgenic lines in our study. We suggest that TaPIN1s in different chromosomes may have subfunctionalization and play different roles in wheat. In addition, different transformation strategies, virus-induced gene silencing, and the Agrobacterium-mediated method may lead to a difference in the expression level of TaPIN1 genes in transgenic plants, which may improve plant height.


In this study, we identified nine homologs of PIN1 genes in wheat, of which TaPIN1-6 genes showed higher expression in the stem apex and young leaf in wheat, and the TaPIN1-6a protein was localized in the plasma membrane. The down-expression of TaPIN1s increased the tiller number in TaPIN1-RNAi transgenic wheat plants, indicating that auxin might mediate the axillary bud production. By contrast, the spikelet number, grain number per panicle, and the 1000-grain weight were decreased in the TaPIN1-RNAi transgenic wheat plants compared with those in the wild type. Our study suggests that TaPIN1s is required for the regulation of grain yield in wheat.


Phylogenetic analysis and protein structure prediction

PIN proteins were aligned with MEGA6.06, and a maximum likelihood phylogenetic tree was prepared with Phylip package using the 500-bootstrap method. The transmembrane helices of TaPIN1 proteins were predicted using TMHMM2 [23] (

Subcellular localization and confocal microscopy

35S::TaPIN1-6a-CDS-GFP was inserted into the pMDC83 vector and infected into Arabidopsis by Agrobacterium tumefaciens (strain GV3101)-mediated transformation to determine the subcellular localization of TaPIN1. Then, T1 transgenic plants were placed in hygromycin (15 mg/L) pressure medium, and after germination, 5 to 6-day-old seedling roots were excised for imaging as described [33]. Staining of roots with FM4-64 was performed as previously described [34,35,36,37,38,39]. Confocal microscopy was performed on the root of the positive Arabidopsis plants with a Leica TCS SP5II (Richmond, IL, USA), and the GFP signal was observed at 505 to 530 nm emission under 488 nm excitation. Fluorescent images were captured using an LSM 880 Airyscan (Zeiss, German) with a 40 × objective. Fluorescence was detected using a 488-nmbandpass filter for GFP. Images were processed using LSM image processing software (Zeiss, German).

In situ hybridization

In situ hybridization and detection of hybridized signals were carried out as described by Meng et al. [40]. The wheat stem apex was fixed in 4% v/v paraformaldehyde (Sigma, USA) and 0.1 M phosphate buffer (pH 7.0) overnight at 4 °C. Then, the specimens were embedded in paraplast (Sigma, USA) and sectioned at 8.0 μm. Antisense and sense RNA probes were synthesized using a digoxigenin RNA labeling kit (Sigma-Aldrich, USA). The antisense RNA probe for TaPIN1-6 genes was amplified by PCR using the upper primer 5′- ACCGGACTACAACGACGCG—3′ and lower primer 5′—GAATTGTAATACGACTCACTATAGGGGCGCCCATCCCATTGTTGTT—3′. The sense RNA probe was amplified by PCR using the upper primer 5′- GAATTGTAATACGACTCACTATAGGGACCGGACTACAACGACGCG—3′ and lower primer 5′—GCGCCCATCCCATTGTTGTT—3′.

Gene expression pattern analysis

Expression pattern analysis of the TaPIN1 genes was performed on the expVIP, which was developed by Ricardo H. Ramirez-Gonzalez (github) and Bijan Ghasemi Afshar (github) as part of the Designing Future Wheat Institute Strategic Program within the Uauy lab ( [41, 42]. The numbers of TaPIN1 genes in wheat EnsemblPlants database were used as a query for the analysis of the expVIP.

Plasmid construction and wheat transformation

For the RNA-interfering plasmid construct, a 242 bp cDNA fragment between 1 and 242 of the TaPIN1s cDNA was amplified by PCR using the upper primer 5′- CACCATGATCACGGGCACGGACTTCT—3′ and lower primer 5′—ATGAGCTTCTGCAGCGTGTCG—3′. The PCR product was inserted into the RNAi vector PC336 to trigger specific RNAi of TaPIN1s in wheat, which created a construct, namely, TaPIN1-RNAi. Then, the construct was transformed into callus initiated from immature embryo of CB037 via A. tumefaciens (strain C58C1)-mediated transformation [43]. Strain C58C1 was kindly provided by Dr. Tom Clemente at the University of Nebraska-Lincoln, USA. The PC336 vector was kindly provided by Dr. Daolin Fu at the Department of Plant, Soil and Entomological Sciences, University of Idaho, Moscow, Idaho, USA.

Molecular identification and qRT-PCR analysis

Genomic DNA was isolated from the putative transgenic wheat plants following the CTAB method [44]. In addition, PCR was used to verify the candidate transgenic plants using the gene-specific upper primer 5′- TTTTAGCCCTGCCTTCATACG—3′ and lower primer 5′—ATGAGCTTCTGCAGCGTGTCG—3′.

Ultrapure RNA Kit (CoWin Bio., China) was used for total RNA extraction according to the manufacturer’s instruction in our experiment, and the transcript levels of TaPIN1 genes in transgenic wheat lines were analyzed by qRT-PCR (Roche Real-Time quantitative PCR, Roche). The first-strand cDNAs were synthesized by using Transcript One-Step gDNA Removal and cDNA Synthesis Supermix (TransGen Biotech Co., LTD, China). qRT-PCR was performed using the gene-specific primers in Table 1 as described by Zhao et al. [45]. The experiments were independently replicated three times under the same conditions.

Table 1 Primers used for qRT-PCR

Plant growth conditions

Wild type and T4 transgenic plants were grown at the Experimental Station of Shandong Agricultural University, Tai’an, Shandong Province, China. Wheat grains were sown and covered with plastic sheeting for insulation on November 17, 2018. Plastic sheeting was removed on March 15, 2019 after 5 days for ventilation and harvested on June 12, 2019. Each experimental line was sown with 25 cm in-row spacing and 10 cm plant-to-plant spacing. Common wheat cv. CB037 was kindly provided by Prof. Xiao Chen at the Institute of Crop Science of the Chinese Academy of Agricultural Sciences in Beijing, China. Arabidopsis for subcellular localization was an ecotype of Columbia-0 (Col.-0), which was planted in the growth room in the Science and Technology Innovation Building of Shandong Agricultural University. The growth room was set at 22 °C and 16 h day-time/8 h night-time mode. Moreover, IBM SPSS Statistics was used in our study for statistical analysis of data.

Availability of data and materials

All data generated or analyzed in this study are included in this published article. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The protein sequences of T. aestivum (Ta) were downloaded from, and the protein sequences of A. tauschii (Ae), A. thaliana (At), B. distachyon (Bd), H. vulgare (Hv), O. sativa L. (Os), P. miliaceum L. (Pm), S. italica (Si), S. bicolor (Sb), T. dicoccoides (Td), T. turgidum subsp. durum (Tt), T. urartu (Tu), and Z. mays (Zm) were downloaded from The accession number of the PIN1 proteins are as follows: TaPIN1-6a (TraesCS6A02G308600.1), TaPIN1-6b1 (TraesCS6B02G337300.1), TaPIN1-6b2 (TraesCS6B02G337300.2), TaPIN1-6b3 (TraesCS6B02G337300.3), TaPIN1-6b4 (TraesCS6B02G337300.4), TaPIN1-6d (TraesCS6D02G287800.1), TaPIN1-7a (TraesCS7A02G190600.1), TaPIN1-7b (TraesCS7B02G095500.1), TaPIN1-7d (TraesCS7D02G191600.1), AePIN1 (XP_020171849.1), AtPIN1 (NP_177500.1), BdPIN1 (XP_003570666.2), HvPIN1 (BAJ97950.1), OsPIN1a (AGV28593.1), OsPIN1b (AGV28594.1), OsPIN1c (XP_015641301.2), OsPIN1d (XP_015619425.1), PmPIN1 (RLM78735.1), SbPIN1c (XP_002436761.1), SiPIN1a (XP_004953880.1), SiPIN1c (XP_022681920.1), TdPIN1 (TRIDC6AG046430.1), TtPIN1 (VAI60845.1), TuPIN1 (TRIUR3_21048), ZmPIN1a (PWZ26735.1), ZmPIN1b (PWZ29332.1), ZmPIN1c (NP_001309394.1), and ZmPIN1d (AQK57225.1).


  1. Leyser O. Regulation of shoot branching by auxin. Trends Plant Sci. 2003;8(11):541–5.

    CAS  Article  Google Scholar 

  2. Wang B, Smith SM, Li J. Genetic Regulation of Shoot Architecture. Annu Rev Plant Biol. 2018;69:437–68.

    CAS  Article  Google Scholar 

  3. Gao XQ, Wang N, Wang XL, Zhang XS. Architecture of Wheat Inflorescence: Insights from Rice. Trends Plant Sci. 2019;24(9):802–9.

    CAS  Article  Google Scholar 

  4. Zhao B, Wu TT, Ma SS, Jiang DJ, Bie XM, Sui N, Zhang XS, Wang F. TaD27-B gene controls the tiller number in hexaploid wheat. Plant Biotechnol J. 2020;18(2):513–25.

    CAS  Article  Google Scholar 

  5. Morris DA. Transport of exogenous auxin in two-branched dwarf pea seedlings (Pisum sativum L.): Some implications for polarity and apical dominance. Planta. 1977;136(1):91–6.

  6. Bennett T, Sieberer T, Willett B, Booker J, Luschnig C, Leyser O. The Arabidopsis MAX pathway controls shoot branching by regulating auxin transport. Curr Biol. 2006;16(6):553–63.

    CAS  Article  Google Scholar 

  7. Wang P, Shen L, Guo J, Jing W, Qu Y, Li W, Bi R, Xuan W, Zhang Q, Zhang W. Phosphatidic Acid Directly Regulates PINOID-Dependent Phosphorylation and Activation of the PIN-FORMED2 Auxin Efflux Transporter in Response to Salt Stress. Plant Cell. 2019;31(1):250–71.

    CAS  Article  Google Scholar 

  8. Friml J, Benkova E, Blilou I, Wisniewska J, Hamann T, Ljung K, Woody S, Sandberg G, Scheres B, Jurgens G, et al. AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell. 2002;108(5):661–73.

    CAS  Article  Google Scholar 

  9. Petrasek J, Mravec J, Bouchard R, Blakeslee JJ, Abas M, Seifertova D, Wisniewska J, Tadele Z, Kubes M, Covanova M, et al. PIN proteins perform a rate-limiting function in cellular auxin efflux. Science. 2006;312(5775):914–8.

    CAS  Article  Google Scholar 

  10. Adamowski M, Friml J. PIN-dependent auxin transport: action, regulation, and evolution. Plant Cell. 2015;27(1):20–32.

    CAS  Article  Google Scholar 

  11. Krecek P, Skupa P, Libus J, Naramoto S, Tejos R, Friml J, Zazimalova E. The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol. 2009;10(12):249.

    Article  Google Scholar 

  12. Tian C, Zhang X, He J, Yu H, Wang Y, Shi B, Han Y, Wang G, Feng X, Zhang C, et al. An organ boundary-enriched gene regulatory network uncovers regulatory hierarchies underlying axillary meristem initiation. Mol Syst Biol. 2014;10:755.

    Article  Google Scholar 

  13. Cao X, Wang J, Xiong Y, Yang H, Yang M, Ye P, Bencivenga S, Sablowski R, Jiao Y. A Self-Activation Loop Maintains Meristematic Cell Fate for Branching. Curr Biol. 2020;30(10):1893–1904 e1894.

  14. Li Y, Xia T, Gao F, Li Y. Control of Plant Branching by the CUC2/CUC3-DA1-UBP15 Regulatory Module. Plant Cell. 2020;32(6):1919–32.

    CAS  Article  Google Scholar 

  15. Gallavotti A, Yang Y, Schmidt RJ, Jackson D. The Relationship between auxin transport and maize branching. Plant Physiol. 2008;147(4):1913–23.

    CAS  Article  Google Scholar 

  16. Gallavotti A. The role of auxin in shaping shoot architecture. J Exp Bot. 2013;64(9):2593–608.

    CAS  Article  Google Scholar 

  17. Xu K, Sun F, Wang Y, Shi L, Liu S, Xi Y. The PIN1 family gene PvPIN1 is involved in auxin-dependent root emergence and tillering in switchgrass. Genet Mol Biol. 2016;39(1):62–72.

    CAS  Article  Google Scholar 

  18. Galweiler L, Guan C, Muller A, Wisman E, Mendgen K, Yephremov A, Palme K. Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science. 1998;282(5397):2226–30.

    CAS  Article  Google Scholar 

  19. Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C. Regulation of phyllotaxis by polar auxin transport. Nature. 2003;426(6964):255–60.

    CAS  Article  Google Scholar 

  20. Carraro N, Forestan C, Canova S, Traas J, Varotto S. ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize. Plant Physiol. 2006;142(1):254–64.

    CAS  Article  Google Scholar 

  21. Xu M, Zhu L, Shou H, Wu P. A PIN1 family gene, OsPIN1, involved in auxin-dependent adventitious root emergence and tillering in rice. Plant Cell Physiol. 2005;46(10):1674–81.

    CAS  Article  Google Scholar 

  22. Skirpan A, Culler AH, Gallavotti A, Jackson D, Cohen JD, McSteen P. BARREN INFLORESCENCE2 interaction with ZmPIN1a suggests a role in auxin transport during maize inflorescence development. Plant Cell Physiol. 2009;50(3):652–7.

    CAS  Article  Google Scholar 

  23. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305(3):567–80.

    CAS  Article  Google Scholar 

  24. Forestan C, Farinati S, Varotto S. The Maize PIN Gene Family of Auxin Transporters. Front Plant Sci. 2012;3:16.

    Article  Google Scholar 

  25. Wang JR, Hu H, Wang GH, Li J, Chen JY, Wu P. Expression of PIN genes in rice (Oryza sativa L.): tissue specificity and regulation by hormones. Mol Plant. 2009;2(4):823–31.

  26. Beveridge CA. Axillary bud outgrowth: sending a message. Curr Opin Plant Biol. 2006;9(1):35–40.

    CAS  Article  Google Scholar 

  27. Ongaro V, Leyser O. Hormonal control of shoot branching. J Exp Bot. 2008;59(1):67–74.

    CAS  Article  Google Scholar 

  28. McSteen P. Hormonal regulation of branching in grasses. Plant Physiol. 2009;149(1):46–55.

    CAS  Article  Google Scholar 

  29. Forestan C, Meda S, Varotto S. ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development. Plant Physiol. 2010;152(3):1373–90.

    CAS  Article  Google Scholar 

  30. Rogg LE, Lasswell J, Bartel B. A gain-of-function mutation in IAA28 suppresses lateral root development. Plant Cell. 2001;13(3):465–80.

    CAS  Article  Google Scholar 

  31. Kebrom TH, Chandler PM, Swain SM, King RW, Richards RA, Spielmeyer W. Inhibition of tiller bud outgrowth in the tin mutant of wheat is associated with precocious internode development. Plant Physiol. 2012;160(1):308–18.

    CAS  Article  Google Scholar 

  32. Singh K, Singh J, Jindal S, Sidhu G, Dhaliwal A, Gill K. Structural and functional evolution of an auxin efflux carrier PIN1 and its functional characterization in common wheat. Funct Integr Genomics. 2019;19(1):29–41.

    CAS  Article  Google Scholar 

  33. Zhang H, Zhang TT, Liu H, Shi Y, Wang M, Bie XM, Li XG, Zhang XS. Thioredoxin-Mediated ROS Homeostasis Explains Natural Variation in Plant Regeneration. Plant Physiol. 2018;176(3):2231–50.

    CAS  Article  Google Scholar 

  34. Wang JG, Li S, Zhao XY, Zhou LZ, Huang GQ, Feng C, Zhang Y. HAPLESS13, the Arabidopsis mu1 adaptin, is essential for protein sorting at the trans-Golgi network/early endosome. Plant Physiol. 2013;162(4):1897–910.

    CAS  Article  Google Scholar 

  35. Zhang YL, Li E, Feng QN, Zhao XY, Ge FR, Zhang Y, Li S. Protein palmitoylation is critical for the polar growth of root hairs in Arabidopsis. BMC Plant Biol. 2015;15:50.

    Article  Google Scholar 

  36. Chai S, Ge FR, Feng QN, Li S, Zhang Y. PLURIPETALA mediates ROP2 localization and stability in parallel to SCN1 but synergistically with TIP1 in root hairs. Plant J. 2016;86(5):413–25.

    CAS  Article  Google Scholar 

  37. Feng QN, Zhang Y, Li S. Tonoplast targeting of VHA-a3 relies on a Rab5-mediated but Rab7-independent vacuolar trafficking route. J Integr Plant Biol. 2017;59(4):230–3.

    CAS  Article  Google Scholar 

  38. Wan ZY, Chai S, Ge FR, Feng QN, Zhang Y, Li S. Arabidopsis PROTEIN S-ACYL TRANSFERASE4 mediates root hair growth. Plant J. 2017;90(2):249–60.

    CAS  Article  Google Scholar 

  39. Xiong F, Duan CY, Liu HH, Wu JH, Zhang ZH, Li S, Zhang Y. Arabidopsis KETCH1 Is Critical for the Nuclear Accumulation of Ribosomal Proteins and Gametogenesis. Plant Cell. 2020;32(4):1270–84.

    CAS  Article  Google Scholar 

  40. Meng WJ, Cheng ZJ, Sang YL, Zhang MM, Rong XF, Wang ZW, Tang YY, Zhang XS. Type-B ARABIDOPSIS RESPONSE REGULATORs Specify the Shoot Stem Cell Niche by Dual Regulation of WUSCHEL. Plant Cell. 2017;29(6):1357–72.

    CAS  Article  Google Scholar 

  41. Borrill P, Ramirez-Gonzalez R, Uauy C. expVIP: a Customizable RNA-seq Data Analysis and Visualization Platform. Plant Physiol. 2016;170(4):2172–86.

    CAS  Article  Google Scholar 

  42. Ramirez-Gonzalez RH, Borrill P, Lang D, Harrington SA, Brinton J, Venturini L, Davey M, Jacobs J, van Ex F, Pasha A et al: The transcriptional landscape of polyploid wheat. Science. 2018;361(6403).

  43. Zhou X, Wang K, Lv D, Wu C, Li J, Zhao P, Lin Z, Du L, Yan Y, Ye X. Global analysis of differentially expressed genes and proteins in the wheat callus infected by Agrobacterium tumefaciens. PLoS One. 2013;8(11):e79390.

  44. Bie X, Wang K, She M, Du L, Zhang S, Li J, Gao X, Lin Z, Ye X. Combinational transformation of three wheat genes encoding fructan biosynthesis enzymes confers increased fructan content and tolerance to abiotic stresses in tobacco. Plant Cell Rep. 2012;31(12):2229–38.

  45. Zhao XY, Hong P, Wu JY, Chen XB, Ye XG, Pan YY, Wang J, Zhang XS. The tae-miR408-Mediated Control of TaTOC1 Genes Transcription Is Required for the Regulation of Heading Time in Wheat. Plant Physiol. 2016;170(3):1578–94.

    CAS  Article  Google Scholar 

Download references


We would like to thank the editors and reviewers for their comments and helpful suggestions.


This work was financially supported by the Shandong Provincial Natural Science Foundation (ZR2016CP05), the Major Program of the National Natural Science Foundation of China (91935302), and the Agricultural Variety Improvement Project of Shandong Province (2019LZGC010). The funding agencies were not involved in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Author information




X.M.B., X.G.L. and X.S.Z. designed the research. F.Q.Y. and X.H.L. performed research. H.W., Y.N.S. and Z.Q.L. analyzed data. X.M.B. and X.Q.G. drafted the manuscript. All authors reviewed the manuscript. The author(s) read and approved the final manuscript.

Corresponding author

Correspondence to Xiao Min Bie.

Ethics declarations

Ethics approval and consent to participate

All experimental research and field studies on plants in our study complies with Chinese institutional, national, and international guidelines and legislation. The planting and management of experimental materials are permitted by the Experimental Station of Shandong Agricultural University (Tai’an, Shandong Province, China).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Yao, F.Q., Li, X.H., Wang, H. et al. Down-expression of TaPIN1s Increases the Tiller Number and Grain Yield in Wheat. BMC Plant Biol 21, 443 (2021).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • TaPIN1 genes
  • Tiller number
  • Grain yield
  • Wheat