Plant materials
Any plant materials used in this study were identified by a curator, Tanawat Chaowasku and deposited publicly as herbariums for further references at the CMUB Herbarium, Department of Biology, Faculty of Science, Chiang Mai University, while their specimen voucher numbers initiated with CMUB are addressed elsewhere in this article.
Thai jasmine rice (O. sativa L. cv. KDML105) seeds (CMUB39907) stored without any treatment for 4–5 months after harvesting in a granary at Si Prachan District, Suphan Buri Province, Thailand. These seeds were commercially produced by a local farmer, and some of which were stored as seed stock for subsequent cultivation. The seeds were collected from the granary with the owner’s permission and guidelines (no license needed), and they showed either apparent or no symptom of DPD. We classified the virulence degrees of DPD of these seeds into Grade A (healthy): no disease symptom, Grade B (unhealthy): 20–30% visible symptom, and Grade C (diseased): 50–100% severe seed damage. The seeds were the sources for isolation of phytopathogenic fungi and used in biopriming experiments.
Two rice cultivars: Oryza sativa L. var. indica cv. Pathumthani 1 (CMUB39903 – CMUB39905) and Oryza sativa L. var. indica cv. RD41 (CMUB39906) were commercially cultivated by the local farmers at different field locations where different herbicides were applied to treat the fields (Table 2). These field-growing rice plants were collected by uprooting from the fields with the owners’ permission and guidelines (no license needed). The farmers also kindly provided the information about the herbicide treatments and the ages of rice plants. The rice plants were packed in plastic bags and preserved in an icebox before transferring to the laboratory. After washing these rice plants several times under running tap water, they were divided as roots, stems, and leaves. Any plant materials had surfaces sterilized by soaking in a series of 70% (v/v) ethyl alcohol for 1 min, 2% (v/v) NaOCl for 2 min, 95% (v/v) ethyl alcohol for 30 s, and 30% (v/v) H2O2 for 1 min. The cleaned plant materials were washed four times with sterile distilled water to remove disinfectant residues and used as the sources for isolating herbicide-tolerant endophytic bacteria.
Isolation of phytopathogenic fungi and their pathogenicity tests
Diseased rice seeds (Grade C) served as the sources for isolation of fungal pathogens causing DPD. These seeds were washed several times under running tap water and their surfaces sterilized with 1% (w/v) NaOCl for 10 min following by a final wash with sterile distilled water. Ten cleaned seeds were pasted on potato dextrose agar (PDA) medium (Difco, USA) and incubated at 22 °C for 5–8 days. The appeared fungal colonies were subcultured on the new PDA medium until becoming axenic cultures and then preserved in 20% (v/v) glycerol for storage and further studies.
Pathogenicity of isolated fungi was tested in vitro at germination and seedling growth phases of healthy rice seeds (Grade A), following Koch’s postulates. Briefly, these seeds had their surfaces sterilized using the same protocol addressed before. For the germination test, five of the cleaned seeds were pasted on autoclaved planting paper and inoculated with 10 mL of sterile distilled water as the control or mycelial suspension made of each fungal isolate, then incubated at 30 °C. The mycelial suspension was prepared by scrapping 7-day-old fungal biomass growing on PDA medium at 30 °C. The biomass was ground in the presence of sterile distilled water, using aseptic mortar and pestle. The final concentration of such mycelial suspension was adjusted to 104 propagules mL− 1 by hemocytometer.
For the test at the seedling growth phase, the cleaned rice seeds were allowed to germinate on moist autoclaved planting papers at 30 °C for 5 days. A seedling produced was aseptically transferred to grow further on Water agar medium in a test tube, where 1 mL of sterile distilled water (control) or each mycelial suspension was inoculated and incubated in a moist chamber at 25 °C. The pathogenicity level (i.e., weak, medium, and virulent) of each isolated fungus was assigned using the germination rate of seeds and seedling health observed every day.
Isolation of herbicide-tolerant endophytic bacteria of rice and their antifungal potentials
The prepared rice plant materials derived from the field cultivations were ground in the presence of sterile distilled water (1 mL), using aseptic mortar and pestle. The suspension (100 μL) of ground plant materials was spread over Luria-Bertani (LB) agar medium (Himedia, India) supplemented with a set of herbicides applying in the field cultivation of rice (Table 2). Also, the washing liquid derived from the last step of the surface sterilization of each plant material described previously (100 μL) was spread over the agar medium and served as a control to verify in planta origin of the bacteria isolated. Four seeded agar plates per each part of plant materials and controls were carried out and incubated at 30 °C for 2 days. The visible bacterial colonies were subcultured onto the new agar medium until becoming axenic cultures, then preserved in 20% (v/v) glycerol for storage and further studies.
Antifungal activity of each isolated bacterium against a set of fungal isolates showing virulent pathogenicity of DPD was assayed using dual culture method on PDA medium. Briefly, a bacterial colony (2-day-old culture growing previously on LB agar medium at 30 °C) was streaked (5-cm in length) on PDA medium at 2-cm away from the edge of the plate. At the opposite of the bacterial streak, the fungal mycelium as a disc of 5.5 mm diameter (5-day-old culture growing previously on PDA medium at 30 °C) was inoculated at 2-cm away from the edge of the plate. All assayed plates were incubated at 30 °C, in which the radius growth of fungal colony was measured every day. Fungal growth in the absence of test bacterium served as the control. The percentage of inhibition was calculated using equation (i), where dcontrol is an average size (ø in mm) of the fungal colony in the control and dassay is that in the dual culture assay. \( \%\mathrm{Inhibition}=\frac{d_{\mathrm{control}}-{d}_{\mathrm{assay}}}{d_{\mathrm{control}}}\times 100 \) (i).
Identification and classification of isolated microbes
The isolated fungi showing virulent pathogenicity of DPD were identified at the generic level, using their internal transcribed spacer (ITS) gene sequence data. Each fungus was grown on PDA medium at 30 °C for 7 days, in which the fungal biomass was scraped out and suspended in sterile distilled water. The biomass collected by centrifugation at 12100 g for 5 min was used for DNA extraction with Plant Genomic DNA Mini Kit (Geneaid Biotech Ltd., Taiwan), following the manufacturer’s instruction. Extracted DNA was the template for amplifying the fungal ITS1–5.8S rDNA – ITS2-26S rDNA region by PCR, using Taq DNA Polymerase and Standard Taq Buffer from New England BioLabs, USA. PCR (25 μL) contained 2.5 μL of 10× Standard Taq Reaction Buffer, 0.5 μL of 10 mM dNTPs, 0.125 μL of Taq DNA Polymerase, 0.5 μL of each 10 μM primer (ITS1: 5′ TTTCCGTAGGTGAACCTGC 3′ and ITS4: 5′ TCCTCCGCTTATTGATATGC 3′ [33]), 0.1 μL of template DNA, and the volume was adjusted with nuclease-free water. PCR was carried out using a thermocycler with the following condition: 5 min initial denaturation at 94 °C, 30 cycles of 1.5 min denaturation at 94 °C, 2 min annealing at 52 °C and 1 min extension at 72 °C, and 5 min final extension at 72 °C.
The isolated bacteria showing excellent antifungal activity were identified at the generic level, using their 16S rRNA gene sequence data. Each bacterium was grown in 50 mL of LB broth with shaking incubation at 250 rpm, 30 °C for 2 days. The bacterial biomass was collected by centrifugation at 12000 g for 5 min and used as the template DNA for amplifying the 16S rRNA gene sequence. Following the same PCR compositions mentioned above, except for the primers that were fD1 5′ AGAGTTTGATCCTGGCTCAG 3′ and rP2 5′ ACGGCTACCTTGTTACGACTT 3′ [34]. PCR was carried out using a thermocycler with the following condition: 5 min pre-denaturation at 95 °C, 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 55 °C and 1.5 min extension at 72 °C, and 10 min final extension at 72 °C.
Any PCR products were sequenced to retrieve their nucleotide sequence data with a service provided by 1st BASE, Singapore. The gene sequences obtained were checked using BioEdit (www.mbio.ncsu.edu/BioEdit/bioedit.html) and identified by comparison with the public nucleotide databases available in GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi) plus MycoBank (http://www.mycobank.org) for the fungal ITS sequences or together with EZBioCloud (www.ezbiocloud.net) for the bacterial 16S rRNA gene sequences. The highly related nucleotide sequences were collected, aligned with MUSCLE, and used for constructing phylogenetic trees in MEGA7 (www.megasoftware.net).
Seed biopriming
The method for biopriming of rice seeds was carried out using modified protocols described by Singh et al. [27] and Sivakumar et al. [35]. Briefly, unhealthy rice seeds (Grade B) were used for biopriming by soaking them in aqueous suspensions of the isolated bacteria showing excellent antifungal activity. Each bacterium was previously grown in LB broth at 30 °C with shaking at 250 rpm for 2 days, and its biomass was collected by centrifugation at 9660 g for 5 min. The bacterial biomass was washed twice, re-suspended and adjusted its optical density (absorbance) at the wavelength of 600 nm using sterile distilled water to 0.2 that corresponded to 108 colonies forming unit per mL. The seeds were soaked in each bacterial suspension for 3, 6, 9, 12, and 15 h, aiming to find the OPD in biopriming. All soaked seeds were air dried at 25 °C till their moisture contents were the same as before priming (~ 12%) monitored by a rice moisture meter, RICETER F-514 (Kett Electric Laboratory, Japan) to avoid the impacts of seed moisture change caused by different priming durations. In parallel, a set of controls was constructed to assess the capacity of seed biopriming, i.e., non-treated or hydroprimed healthy and unhealthy seeds. For seed hydropriming, it was carried out in the same way as for biopriming but used solely sterile distilled water (no bacterial cells). Besides, unhealthy seeds mixed with 1.3% (w/w) Benomyl (Sims Agrow Cheme, Thailand) served as a chemical fungicide-treated control in pot experiments. Any rice seeds with and without treatment were kept at 4 °C for 6 months before use in further assessments.
Post-biopriming assessments in the full life cycle of the rice crop
The impacts of seed biopriming on fertility recovery and disease suppression of unhealthy rice seeds, since seed germination until harvesting of rice yield were evaluated. GP, GI, MGT, DI, and lengths of seedlings’ roots and shoots, were evaluating factors at the germination and seedling growth phases and also used as the criteria for assigning OPD in biopriming. These parameters were quantified after allowing seeds to germinate by a standard between-paper germination test described in the International Seed Testing Association’s handbook [36]. Non-treated, hydroprimed or bioprimed healthy and unhealthy rice seeds previously prepared were used in these measurements, which were carried out in four replications (100 seeds per each) and incubated at 25 °C in plastic bags to prevent humidity loss.
The germinated seeds counting for the first time on the third day of incubation and the seventh day for the last count were recorded and subjected to the calculation of GP [36]. GI was calculated using the equation (ii) described in the Association of Official Seed Analysts’ handbook [37], in which Gx is the number of germinated seeds counting at day x.
$$ \mathrm{GI}=\frac{G_1}{1}+\frac{G_2}{2}+\dots +\frac{G_x}{\mathrm{x}} $$
(ii)
The equation (iii) described by Ellis and Roberts [38] was used to calculate MGT, where n is the number of seeds germinating on day d and d is the number of days counting from the beginning of germination.
$$ \mathrm{MGT}=\frac{\sum d\cdot n}{\sum n} $$
(iii)
At the seventh day after allowing rice seeds to germinate, DI scores were determined using the grain discoloration criteria of Mew and Misra [39] as no incidence = 0, < 1% = 1, 1–5% = 3, 6–25% = 5, 26–50% = 7, and 51–100% = 9. Based on this scoring, DI was computed using the equation (iv), where each N3, N5, N7, and N9 is respectively the number of seedlings with score 3, 5, 7, and 9, and Nt is the total number of scored seedlings.
$$ \mathrm{DI}=\frac{N_3+{N}_5+{N}_7+{N}_9}{N_t} $$
(iv)
Lengths of seedlings’ roots and shoots were measured using 14-day-old rice seedlings emerging from any treated and control seeds.
The pot experiments were constructed to assess how seed biopriming benefits rice cultivation and quality of rice yield produced. The tests were conducted with a randomized complete block design with five replications (4 pots per each) under the controllable greenhouse conditions. Each container (ø = 8 in, height = 25 cm) was filled with 2 kg of agricultural soil homogenized with coir and cow manure at a ratio of 4/1/1 (w/w/w). The soil type was clayey loam identified by the hydrometer method [40]. The 14-day-old rice seedlings emerging from either non-treated or treated seeds were prepared in the same way as addressed previously. At least three seedlings were planted at the center of each pot and allowed to grow for 5 days when only the best-grown seedling was remained. With the aim to imitate the field conditions for commercial rice cultivation, every pot was fertilized twice with 30 g of Nitrogen-Phosphorus-Potassium (N46-P0-K0) fertilizer for the first time (20 days after planting) and 60 g of N16-P16-K16 for the last time (45 days after planting). The field concentration of each fertilizer denoted by farmers was 30 and 60 kg ha− 1 for N46-P0-K0 and N16-P16-K16, respectively. A set of herbicides was also applied twice by spraying on soil surrounding rice plants when they were 10 and 25 days old. The herbicides used were 0.64 mL L− 1 Clomazone plus 1.44 mL L− 1 Propanil for the first time and 0.276 mL L− 1 Fenoexprop-P-Ethyl for the second time. The growth phases of rice after planting comprised of seedling (day 0–14), tillering (day 30–60), flowering (day 75–100), and harvesting (day 120). Growth and health indexes of rice, including the height of rice plants at every growth phase and the numbers of tillers and panicles per hill, the weight of 1000 healthy rice grains and the percentage of healthy rice yield at the harvesting stage were measured and used to determine the benefits of seed biopriming.
Analyses of seedling phytochemicals
As well-being indicators, two phytochemicals, i.e., antioxidants and total phenolic contents in rice seedlings’ roots and shoots were quantified using modified colorimetric methods described by Sadh et al. [41]. Non-treated, hydroprimed or bioprimed healthy and unhealthy rice seeds previously prepared were used to produce 14-day-old seedlings. A modified DPPH radical scavenging assay was used to measure antioxidant activity. Briefly, 500 mg of seedlings’ shoots or roots was extracted using 2 mL of 95% (v/v) ethanol, and the mixture was precipitated by cold centrifugation (4 °C) at 9660 g for 20 min. The derived supernatant or the extracting solvent as a control (0.5 mL) was mixed with 3 mL of 60 M DPPH by vortexing and incubated in the dark at 25 °C for 30 min. The absorbance at 517 nm (A517) of the produced mixture was measured by a spectrophotometer, while the antioxidant activity was determined with the percentage of DPPH radical inhibition, using the modified equation (v).
$$ \%\mathrm{DPPH}\ \mathrm{radical}\ \mathrm{inhibition}=\frac{A_{517\ \mathrm{control}}-{A}_{517\ \mathrm{extract}}}{A_{517\ \mathrm{control}}}\times 100 $$
(v)
For the quantification of the total phenolic contents, 50 mg of seedlings’ shoots or roots was extracted by mixing with 2.5 mL of 95% (v/v) ethanol and incubated at 0 °C for 48–72 h. The extract was combined using a homogenizer and precipitated by cold centrifugation (4 °C) at 9660 g for 10 min. The derived supernatant or the extracting solvent as a control (1 mL) was mixed with 2.5 mL of 95% (v/v) ethanol, 5 mL of sterile distilled water, and 0.5 mL of 50% (v/v) Folin-Ciocalteu reagent, by vortexing and left at 25 °C for 5 min. The mixture was added with 1 mL of 5% (v/v) Na2CO3 and incubated in the dark at 25 °C for 1 h. The absorbance at 725 nm of the produced mixture was measured by a spectrophotometer, while the total phenolic content in mg gallic acid per g fresh weight of plant materials was calculated by corresponding the absorbance values to the standard curve of the known gallic acid concentrations.
Confirmation of in planta colonization by herbicide-tolerant endophytic bacteria
The capability of PGP bacteria to colonize the interiors of rice is a promising feature that these bacteria can benefit the entire life cycle of rice growth and development. ERIC-PCR [42] was carried out to confirm the in planta colonization of the bacteria selected for seed biopriming. Briefly, surface-sterilized roots and shoots of 14-day-old rice seedlings emerging from bioprimed seeds were prepared as described previously. The cleaned plant materials (1 g) were ground in the presence of sterile distilled water (9 mL), using aseptic mortar and pestle. The ground plant suspension (1 mL) was diluted 10-fold serially, and 100 μL of some dilutions (103–105) was spread over LB agar medium supplemented with a set of herbicides used for the bacterial isolation. The experiments were carried out in triplicate, and the growing bacterial colonies were collected randomly and used as a template DNA for ERIC-PCR, while axenic cultures of the bacteria selected for seed biopriming served as the controls. A pair of primers [43], including ERICIR (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC2 (5′-AAGTAAGTGACTGGGGTGAGCG-3′) was used in ERIC-PCR, in which the other PCR compositions were the same as mentioned before. ERIC-PCR was performed using a thermocycler with the following condition: 5 min pre-denaturation at 95 °C, 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 52 °C and 1 min extension at 72 °C, and 10 min final extension at 72 °C. The PCR product (10 μL) was analyzed using 1.5% (w/v) agarose gel electrophoresis at 100 V for 3 h. The DNA fingerprint on the gel was viewed and imaged by a Gel Doc™ XR+ Gel Documentation System (Biorad, USA), after staining with 0.5 g mL− 1 ethidium bromide. The fingerprints derived from different bacterial colonies and controls were clustered and analyzed for their similarity percentage by using PAST version 3.20 (https://folk.uio.no/ohammer/past/) [44].
Statistical analysis
Comparisons of mean values and standard deviations (SDs) obtained from any measurements were performed using the independent-samples t-test or analysis of variance (ANOVA) with Tukey’s post hoc tests, all available in the SPSS version 25.0 (SPSS, Chicago IL, USA) software package. The statistical results and significance (P) levels (P ≤ 0.05) are addressed elsewhere in this article.
