Skip to main content

Table 6 Primer pairs for RT-qPCR and PCR of CpMS1

From: Differential gene expression among three sex types reveals a MALE STERILITY 1 (CpMS1) for sex differentiation in papaya

GenePrimer FPrimer RTm (C)
Actin 2TTTCCAAGGGTGAGTATGATGAGACACAGGACACAAAAGCCAACTA58
EIF 1AGGCAGGCAAGAGAAGATTTCATACCGAGTAGCGATTC58
TBP 1GGTAGTAGTAGTTAGGTATGTGGGCAATCTGGTCTCACTT58
CpMS1ATGGTCAGCTAAGCGAGTTGCGGGTTTAAGCTACGACGAA58
CpMS1–1TTGGAAATTAACAAAACGAGAAATGGAGAGATTTCTTCAAAAGTTG55
CpMS1–2GCAATGGCCTCTTTGTTGTTTCCTGCCTTCCAAAAGATCA55
CpMS1–3TCAACTCGCTTAGCTGACCATGTGAAGGTGGGTGTGATGT55
CpMS1–4AACCCACTTCGACTCCATTGTTTCTCCATTTGCAGTGTTTCTT55