Skip to main content

Table 1 List of primer sequences used in the experiments

From: Alleviating dormancy in Brassica oleracea seeds using NO and KAR1 with ethylene biosynthetic pathway, ROS and antioxidant enzymes modifications

Gene Name NCBI Reference Number Direction Primer Sequences (5’…..3’)
BO-ACS1 X82273 Forward GCAGAGAAGCAAGACCAGAA
Reverse TTTCTCGCCGTGTCCGTC
BO-ACS3 AF338652 Forward GGATAGTGATGAGTGGCGG
Reverse TCGGCGAGGCAGAACATA
BO-ACS4 AB086353 Forward GGATAGTGATGAGTGGCGG
Reverse CCCCGCCACTCATCACTA
BO-ACS5 AF074930 Forward TGAAAACCAGCTATGTTTCGATCTT
Reverse AAGATCGAAACATAGCTGGTTTTCA
BO-ACS7 AF338651 Forward CAAATGGGGCAAGCGGAGAATCAGG
Reverse CCTGATTCTCCGCTTGCCCCATTTG
BO-ACS9 AF074929 Forward TGCTTTTCTTTTACCCACTC
Reverse GCTCCCGTTCTCCATTTC
BO-ACS11 AF074928 Forward AACAAACTACTATGTAAAAAATCCTG
Reverse AACTGATTCTTCGTTTTTTTTC
BO-ACO1 X81628 Forward GAGAAGTTGAGGATGTTGATTG
Reverse CCAATCAACATCCTCAACTTC
BO-ETR1 AF047476 Forward GCTCAAACACAGTCTTTAGCGAC
Reverse ATCACACTAAACCTCGCACCAG
BO-ETR2 AB078598 Forward GGTGATAACCAACGGCAGG
Reverse CGTGGCTCCTTAGGCTGAA
BO-ACT1 AF044573 Forward GCTCCCAGGGCTGTTTTC
Reverse CATCAGCCTCAGCCATTTTT