Skip to main content

Table 4 Primers used for qRT-PCR analysis and candidate loci sequencing

From: Mapping and candidate gene screening of tomato Cladosporium fulvum-resistant gene Cf-19, based on high-throughput sequencing technology

Primer name Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’)
qRT-PCR primers   
qRT-5730A CTGGATCGCCCATTTCACCT CCCATGTAACTCTGTGCCTGA
qRT-5760A TCTCATGGGTTACGGTTGTGG TTCAAGTTTGTGTCTGATTTCTGT
qRT-5780A CTCACCTCATTTGTGCCCCA ATCACTTGCCCTGTCGTCTC
qRT-5870A ATTGGCGGTGAAATCCCACA AACCATAACCCACGAGCACC
qRT-6550A TTTAGTGCAGAAATGGGTTGTGT CACTTGTCCTGTCGTCTCGT
qRT-8390A TCAGATGCTATTAGATTCAGACCTC GTGGGAGACCTAACAGTGAGC
qRT-8410A AGTTCTCAGTATCCAGAGTAGCCT AGAAATTGGTCCTTCGAGATGGT
EFα1 CCACCAATCTTGTACACATCC AGACCACCAAGTACTACTGCAC
Sequencing primers
Cf-4/9-1 TTCGTAGACCAAATTAGCT CTAGTTTGACCAATGTGAAG
Cf-4/9-2 TGGTCATTGATCTTCTAA ACAGTTGGATTAGTAGGATTAC
Cf-4/9-3 AAGGTGTACCTTATAGCAT GCGTTCGAGTGTTTTCGGGGAA
S5870A AACAAAAGTCTTAATTATTTATA ACCAATTTCCCAGTTCTCGATA
S5870B GCTTATTCCAGTCCAATT CACTTAATGCATTGGCAAAAAGA