- Research article
- Open Access
Comparative genomic analysis and expression of the APETALA2-like genes from barley, wheat, and barley-wheat amphiploids
- Javier Gil-Humanes1,
- Fernando Pistón1,
- Antonio Martín1 and
- Francisco Barro1Email author
https://doi.org/10.1186/1471-2229-9-66
© Gil-Humanes et al; licensee BioMed Central Ltd. 2009
- Received: 26 February 2009
- Accepted: 29 May 2009
- Published: 29 May 2009
Abstract
Background
The APETALA2-like genes form a large multi-gene family of transcription factors which play an important role during the plant life cycle, being key regulators of many developmental processes. Many studies in Arabidopsis have revealed that the APETALA2 (AP2) gene is implicated in the establishment of floral meristem and floral organ identity as well as temporal and spatial regulation of flower homeotic gene expression.
Results
In this work, we have cloned and characterised the AP2-like gene from accessions of Hordeum chilense and Hordeum vulgare, wild and domesticated barley, respectively, and compared with other AP2 homoeologous genes, including the Q gene in wheat. The Hordeum AP2-like genes contain two plant-specific DNA binding motifs called AP2 domains, as does the Q gene of wheat. We confirm that the H. chilense AP2-like gene is located on chromosome 5Hch. Patterns of expression of the AP2-like genes were examined in floral organs and other tissues in barley, wheat and in tritordeum amphiploids (barley × wheat hybrids). In tritordeum amphiploids, the level of transcription of the barley AP2-like gene was lower than in its barley parental and the chromosome substitutions 1D/1Hch and 2D/2Hch were seen to modify AP2 gene expression levels.
Conclusion
The results are of interest in order to understand the role of the AP2-like gene in the spike morphology of barley and wheat, and to understand the regulation of this gene in the amphiploids obtained from barley-wheat crossing. This information may have application in cereal breeding programs to up- or down-regulate the expression of AP2-like genes in order to modify spike characteristics and to obtain free-threshing plants.
Keywords
- Durum Wheat
- Single Nucleotide Polymorphism
- Chinese Spring
- Wild Barley
- Chromosome Substitution
Background
One of the main objectives of cereal breeding is to expand genetic variability within cultivated species. Wild species, related to cultivated crops, are an important source of variability. Inter-specific hybridization can be used to introgress genetic variability from wild species into crops and to produce new species with valuable agronomic traits. An example of this is the hexaploid tritordeum, an amphiploid obtained by crossing Triticum turgidum L. (Thell) (2n = 4x = 28) with Hordeum chilense (Roem. et Schult.) (HchHch, 2n = 2x = 14). Primary tritordeums exhibit enormous genetic variability for many valuable agronomic and quality traits. For example, the grain and flour from tritordeum has similar functional properties to bread wheat [1], but with higher pigment content [2, 3]. Most of this genetic variability can be attributed to H. chilense, a wild relative of cultivated barley (H. vulgare L.) that occurs exclusively in Chile and Argentina which is highly polymorphic both morphologically and biochemically. The variability for important agronomic traits, such as endosperm storage proteins [4, 5], carotenoid content [6] and resistance to biotic stresses [7], linked to its high crossability, makes H. chilense a suitable candidate as a source of genetic variability for the transfer of useful genes to wheat by wide crossing. However, in the process of hybridization, undesirable traits such as rachis brittleness and non-free threshing characters, present in wild barley, are also transferred to the hybrid, limiting its use as an alternative cereal crop.
Many genetic systems have been proposed as responsible for the free-threshing character in hexaploid wheat. MacKey [8] proposed a polygenic system distributed throughout the three genomes that counteracts glume tenacity and rachis brittleness. A second system is related to the major gene or gene complex Q [9, 10] located in the long arm of the chromosome 5A which governs the free-threshing character and square spike phenotype. In addition, the Q gene pleiotropically influences many other characters determinant for domestication such as rachis fragility [9, 11], glume shape and tenacity [10, 12], spike length [10, 13], plant height [10, 13, 14] and spike emergence time [13]. Other genes which influence the free-threshing habit include the Tg locus, located on chromosome 2D [11, 15] that codes for tenacious glumes and is thought to inhibit the expression of the Q gene.
Simons et al. [16] have cloned and characterized the Q gene in wheat and showed that it has a high homology to members of the APETALA2 (AP2) family of transcription factors. This gene family is characterized by two plant-specific DNA binding motifs referred to as AP2 domains. The AP2 genes form a large multigene family, and play multiple roles during the plant life cycle being key regulators of many developmental processes such as floral organ identity determination or control of leaf epidermal cell identity [17]. Many studies in Arabidopsis have revealed that the AP2 gene is implicated in the establishment of floral meristem identity [18, 19], floral organ identity [20–22] and the temporal and spatial regulation of flower homeotic gene expression [23].
In the present work, we have cloned and characterised an AP2-like gene from accessions of H. chilense and H. vulgare, wild and domesticated barley respectively, and compared these with other homoeologous genes, including the Q gene from wheat. The pattern of expression of the AP2-like gene in floral organs and other tissues in barley, wheat and amphiploid tritordeum was also studied. The results are relevant to understanding the role of the AP2-like gene in the spike morphology of barley and wheat and in hybrids obtained from their crossing and for modification of the expression of AP2-like genes to modify the spike characteristics of cereals for breeding purposes. In addition, the results provide insight into how important agronomic genes such as AP2 are regulated in cereal hybrids.
Results
Structure of the AP2-like genes from H. vulgare and H. chilenseand their predicted proteins
Illustrated structure of the AP2 -like gene in wild ( H. chilense ) and cultivated ( H. vulgare ) barley. Exons are represented by arrows and introns by grey bars. AP2 domains and the miRNA172 binding site are also represented.
Description of the AP2-like genes (genomic DNA, ORF and predicted protein) of H. vulgare cv. Betzes (H106), H. vulgare cv. Forester, H. chilense lines H11 and H208 and T. aestivum cv Chinese spring.
Genomic DNA(1) | ORF | Protein | % of identity(2) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Length (bp) | GC% | Number of | Length (bp) | GC% | Length (aa) | MW (KDa) | pI | Genomic DNA | ORF | Protein | ||
Introns | Exons | |||||||||||
T. aestivum | ||||||||||||
cv. Chinese spring [GenBank: AY702956] | 3229 | 53.3 | 9 | 10 | 1344 | 65 | 447 | 48.968 | 6.72 | 100 | 100 | 100 |
H. vulgare | ||||||||||||
cv. Betzes (H106) | 3234 | 51.4 | 9 | 10 | 1323 | 64.1 | 440 | 48.424 | 7 | 82.1 | 92 | 91.5 |
cv. Forester [GenBank: AY069953] | n/a | n/a | n/a | n/a | 1323 | 64.2 | 440 | 48.081 | 7.31 | n/a | 91.9 | 89.8 |
H. chilense | ||||||||||||
H11 | 3244 | 52.2 | 9 | 10 | 1323 | 64.3 | 440 | 48.315 | 6.94 | 82.9 | 92.5 | 91.3 |
H208 | 3240 | 52.3 | 9 | 10 | 1323 | 64.6 | 440 | 48.273 | 6.97 | 83 | 92.6 | 91.8 |
Nucleotide polymorphism analysis of the AP2 open reading frame (ORF) in H. vulgare line H106 and H. chilense lines H11 and H208.
Genotype | Genotype | ||||||
---|---|---|---|---|---|---|---|
position | H106 | H11 | H208 | position | H106 | H11 | H208 |
21 | C | G | G | 618 | G | C | C |
27 | T | G | G | 708 | G | T | T |
33 | C | G | G | 711 | C | T | T |
63 | C | T | T | 738 | G | C | C |
80* | CCG | - | - | 744 | C | T | T |
86 | C | G | G | 754* | A | C | C |
120 | C | T | T | 768 | G | A | A |
137* | A | G | G | 771 | A | G | G |
144 | G | T | T | 774* | T | A | A |
180 | G | C | C | 817* | A | C | C |
190* | C | T | T | 861 | T | T | G |
210 | C | G | G | 874 | A | C | C |
219 | G | C | C | 914* | A | G | G |
233* | C | T | C | 954 | G | A | A |
258 | A | G | G | 975 | C | T | T |
261 | T | G | G | 1086 | C | G | G |
300 | C | G | G | 1117* | T | A | A |
304* | A | G | G | 1139* | C | A | A |
305* | A | C | C | 1141* | T | C | C |
354 | C | G | C | 1143* | C | G | G |
402 | T | C | C | 1212 | T | C | C |
450 | C | T | T | 1270* | - | GCGCCG | GCGCCG |
453 | A | G | G | 1285* | TCA | - | - |
576 | T | C | C | 1289* | C | T | C |
597 | C | G | G | 1294 | C | G | G |
612 | G | A | A | 1315 | G | C | C |
Alignment of the AP2-like proteins of Arabidopsis thaliana (AAC13770), Oryza sativa[GenBank: AAO65862], Zea mays[GenBank: AAC05206], Triticum aestivum[GenBank: AAU94922], Hordeum vulgare cv. Forester [GenBank: AAL50205] and the predicted protein from the AP2 -like gene of H. vulgare cv. Betzes (H106) and H. chilense lines H11 and H208. Different features (motif 1, motif 2, nuclear localizing signal, AP2 domains R1 and R2, and motif 3) are boxed. The α-helical structures located in the core region of each AP2 domain are delimited by arrows.
Chromosomal location of the AP2-like gene in H. chilense
PCR of the barley AP2 genomic sequence using the primers pair AP2*F2/AP2Hch*R2 with different genotypes of H. chilense (H1), T. aestivum (cv. Chinese Spring and a 5H ch addition line of cv. Chinese spring), and tritordeum (HT374, HT382 and HT22).
Quantitative real-time PCR of AP2-like genes
PCR primers used in this work
Primer | Description | Sequence (5'-3') |
---|---|---|
F1APT2 | external forward for 3' RACE | CTGGAGGCCGACATCAACTTCAATCTG |
F2APT2 | nested forward for 3' RACE | GGAGCTCSAAGTACCGCGGCGTCAC |
R1APT2 | external reverse for 5' RACE | TGGGTACAAACGCTGGTGCTGCTGAG |
R2APT2 | nested reverse for 5' RACE | AAGGCCGGCGATGATGTTGTCCCTCTTG |
AP2F4 | forward for "edge-to-edge" | CGGCCACCGCGCTCCCATGCCATA |
AP2 new R | reverse for "edge-to-edge" | CACACCCGTCGACCRCCGTCCAT |
F3APT2 | forward for DNA sequencing | GAYTGCGGGAAGCAGGTCTACTTG |
F4APT2 | forward for DNA sequencing | AGATGCTMCACCTGACGTCGAAAATGAG |
R5APT2 | reverse for DNA sequencing | CTTCAACTTCGCTGTCRAAMAGCCCAAGAT |
AP2*F2 | forward for qRT-PCR | GGCCGCTGGGAGGCAAGGATGG |
AP2Ta*R2 | reverse for qRT-PCR (genomes A, B and D) | GCCGCCCTGTCGTACGCCCTTG |
AP2Hch*R2 | reverse for qRT-PCR (genome H) | GAAGCGCCGCCCTATCGTAGGCTCT |
Actin F4 | forward for actin gene | ACCTTCAGTTGCCCAGCAAT |
Actin R4 | reverse for actin gene | CAGAGTCGAGCACAATACCAGTTG |
Dissociation curves and agarose gel electrophoresis of the wheat AP2 and barley AP2 amplification products. (A) Dissociation curves and agarose gel electrophoresis of the AP2 qRT-PCR products of genotypes H1 (H. chilense), H106 (H. vulgare cv Betzes), T22 (T. durum) and BW208 (T. aestivum). (B) Dissociation curves and agarose gel electrophoresis of the wheat AP2 (Ta) and barley AP2 (Hch) specific qRT-PCR products of the three tritordeum lines HT22, HT374 and HT382.
Relative expression of the AP2 -like gene in roots, stems, leaves and developing spikes in different genotypes. (A) and (B) Relative expression in genotypes H1 (H. chilense), H106 (H. vulgare cv Betzes), T22 (T. durum) and BW208 (T. aestivum). (C) and (D) Relative expression of the wheat AP2 and barley AP2-like genes in three tritordeum lines (HT22, HT374 and HT382).
Ratio between the expression of wheat AP2 and barley AP2 (wheat AP2 /barley AP2 ) in different tissues of the tritordeum line HT22 and its parents, H1 ( H. chilense ) and T22 ( T. durum ).
Discussion
Alignments of the sequenced cDNA and DNA of the H. chilense lines H11 and H208, and H. vulgare line H106 have shown that the internal structure of exons and introns of the AP2-like gene described in this work (Figure 1) is the same as that reported for the Q gene in wheat [GenBank: AY702956] [16], with 10 exons and 9 introns. BLAST searches revealed that the sequenced genes belong to the AP2 family of transcription factors which includes the floral homeotic gene AP2 [22] and AINTEGUMENTA (ANT) [24, 25] involved in lateral organ development by controlling cell number and growth [26, 27]. AP2-like genes are distinguished by having two plant-specific DNA binding motifs called AP2 domains and function as key developmental regulators in reproductive and vegetative organs [17]. Additionally, the AP2-like genes possess one microRNA172 binding site in the 3' region (Figure 1). The microRNA miR172 with 21-nucleotide non-coding RNA was reported to down-regulate several Arabidopsis genes in the AP2 subfamily [28, 29]. This miR172 and its target sequence are highly conserved in all the genotypes aligned in Figure 2, with only a single change in the sequence of the T. aestivum cv Chinese spring [GenBank: AY702956].
The conserved DNA binding motifs, referred to as AP2 domains R1 and R2, consist of 60 and 61 amino acids respectively and the alignment with other AP2-like proteins confirmed that these domains are highly conserved, even between non-related species such as H. chilense and A. thaliana (Figure 2). Jofuku et al. [22] isolated and characterized the AP2 gene from A. thaliana [GenBank: U12546] and reported a 53% of identity between the two AP2 domains R1 and R2 in the central core of the AP2 polypeptide. They also described the presence of an 18-amino acids conserved core region in the two AP2 domains with a 72.2% of identity between them. This region is theoretically capable of forming amphipathic α-helical structures that may participate in protein-protein interactions. This α-helical structure could also participate in DNA binding, perhaps through the interaction of its hydrophobic face with the major groove of the DNA, as described for other proteins with similar α-helical structure [30]. In the study reported here, the AP2 R1 domain from H. chilense line H11 has 95% of identity with the corresponding amino acid sequence of that from A. thaliana described by Jofuku et al.[22], while the conserved core region is identical. On the other hand, when comparing the AP2 R2 domain of the two species we found 83.6% of identity in the full domain and 72.2% in the core region. Jofuku et al. [22] also reported the presence of a highly basic 10-amino acids domain adjacent to the AP2 R1 domain that included a putative nuclear localization sequence KKSR [31, 32] which suggested that the AP2 may function in the nucleus. The same domain of 10 amino acids is present in the sequences reported here with only a change in the second position of the nuclear localization sequence (threonine instead serine) which is conserved in all the Triticeae sequences of the AP2-like proteins aligned in Figure 2. Tang et al. [33] described the amino acid sequences of the three motifs found in the AP2-like protein in rice and compared it with other AP2-like proteins from different species. We have found similar structures in the predicted AP2-like proteins of wild (H11 and H208) and cultivated (H106) barley (Figure 2).
Previous experiments involving the cytogenetic analysis of aneuploids have located the Q gene in the long arm of chromosome 5A of the wheat genome [9, 34]. The H. chilense genome has been demonstrated to be collinear to other Triticeae genomes including those of bread wheat and H. vulgare [35] so that the AP2-like gene was predicted to be on chromosome 5Hch of H. chilense. To confirm this, the AP2-like gene from H. chilense was amplified by PCR in H. chilense (H1), T. aestivum cv. Chinese Spring, a 5Hch addition line of T. aestivum cv. Chinese spring, an amphiploid tritordeum (HT22), and two tritordeum lines HT374 and HT382 carrying chromosome substitutions (Figure 3). The results confirmed that the barley AP2-like gene is located on chromosome 5Hch and that the HT374 substitution line (5D/5Hch) effectively lacks this chromosome.
Expression of the AP2-like gene was detected in all tissues studied. The transcription level peaked in the early stages of spike development and gradually decreased with spike maturation, being very similar in all the genotypes tested when the spike was fully emerged. These results are similar to those reported by Simons et al. [16] who observed higher expression of the Q gene in developing spikes, with a peak at the first stages of spike growth in wheat genotypes. Simons et al. [16] also reported lower expression in non-floral organs such as leaves and roots. Jofuku et al. [22] studied the transcription of AP2 in A. thaliana obtaining expression in floral organs (sepals, petals, stamens, carpels, developing ovules and inflorescence meristems) and also in non-floral organs (stems and leaves).
We characterised the expression of the AP2-like gene in wild (H. chilense genotype H1) and cultivated barley (H. vulgare genotype H106) (Figure 4) and found a higher level of transcription in wild barley in roots, stems and developing spikes. Simons et al. [16] reported that the transcription level of the Q allele, contained in bread and durum wheat cultivars, was consistently higher than that of q allele, contained in wild wheats, and this was related with differences in spike morphology. They also described that the single amino acid difference found in their predicted proteins could provide higher efficiency in homodimer formation in the Q allele with respect to that of the q allele. They suggested that the Q protein homodimer complex recognizes a region on its own promoter, enhancing the expression of the Q allele and leading to higher levels of the Q protein, and this was related to phenotypic differences in spike morphology between cultivated and wild wheats. Despite this, differences between Q and q can be compensated by a gene dosage effect, with 2.5 doses of q being equal to 1 dose of Q [10].
Our results with wild and cultivated barley showed that H. chilense (wild) had higher AP2-like gene expression levels than H. vulgare (cultivated). According to the model proposed by Simons et al., [16], in the case of barley, the homodimer formation should be higher in H. chilense than that of H. vulgare, resulting in higher transcript levels of the AP2-like gene in H. chilense. As for wheat, differences in expression levels for the AP2-like gene in wild and cultivated barley could be responsible for phenotypic differences in spike morphology. However, in barley, the line showing higher expression levels of the AP2-like gene is H. chilense which is not the cultivated phenotype. Hence, the wheat model does not entirely fit to barley, either because the mechanism in barley is different or because the mechanism is more complex than that reported by Simons et al. [16]. In the case of wheat, the Q and q alleles differ only by one amino acid while the AP2-like genes from wild and cultivated barley differ by 17 amino acids. Therefore, differences in the spike morphology between wild and cultivated barley may not only be due to AP2-like gene expression level, but additional elements must be added to the model to explain better the contribution of the AP2-like gene to spike morphology in barley.
We have also characterised the expression of the AP2-like genes corresponding to wheat and barley genomes in tritordeum amphiploids (HT22, HT374 and HT382). The comparison of the expression as wheat/barley AP2 ratio when both genes are expressed together in the tritordeum amphiploid (HT22) and when they are expressed separately in their parental lines, H. chilense (H1) and T. durum (T22), showed that the relative expression of the wheat AP2-like gene in different tissues was very constant in the amphiploid and in its durum wheat parental (T22). However, the level of transcription of the barley AP2-like gene was 3.5 times lower in the amphiploid than in its barley parental (H1). This could be explained by the presence of a mechanism of regulation for the barley AP2-like gene that makes it differently expressed in the amphiploid and in barley. One of the consequences of this down-regulation of the barley AP2-like gene may be the aspect of the spike in the tritordeum amphiploid, which is more similar to that of durum wheat than that of wild barley. However, many important agronomic features of the spike in tritordeum, such as fragile rachis and non-free threshing habit are similar to H. chilense.
Two tritordeum substitution lines (HT374 and HT382) with free-threshing habit [36] showed only expression of the wheat AP2-like gene. This was predictable for line HT374, which has a 5D/5Hch chromosome substitution and consequently lacks the barley AP2-like gene, but not for line HT382 (double substitution 1D/1Hch and 2D/2Hch) which carries the 5Hch chromosome and therefore the barley AP2-like gene. Thus in this case, expression of the barley AP2-like gene was affected also by substitution of chromosomes 1Hch and/or 2Hch. Atienza et al. [36] proposed that the presence of a homoeologous q locus on chromosome 5Hch would be responsible for the non-free-threshing habit in tritordeum, and consequently the substitution of 5D/5Hch in the line HT374 was responsible of the free-threshing habit. It was also suggested that the absence of chromosome 2Hch conferred the free-threshing habit in tritordeum HT382, because of the absence of a homoeologous Tg locus from H. chilense that codes for tenacious glumes, in spite of the presence of q Hch locus on chromosome 5Hch [36]. Kerber et al. [15] and Jantasuriyarat et al. [11] have proposed that the action of Tg during flower development directly or indirectly interferes with the Q gene. The results reported from our work support this hypothesis as it appears that the absence of chromosome 2Hch in tritordeum HT382 affects on the expression of the barley AP2-like gene, reducing its transcription to low levels.
Conclusion
The AP2-like gene from wild and cultivated barley has been characterised in this work. The AP2-like genes contain two plant-specific DNA binding motifs called AP2 domains as does the Q gene of wheat. The results confirmed that the barley AP2-like gene is located on chromosome 5Hch. The expression of the AP2-like genes were studied in wheat, barley and tritordeum amphiploids showing that the level of transcription of the barley AP2-like gene in tritordeum was lower than in its barley parental. The chromosome substitutions 1D/1Hch and 2D/2Hch influence the expression of the barley AP2 in tritordeum. The results are of interest in understanding the role of the AP2-like gene in the spike morphology of cereals and in understanding the regulation of this gene in barley × wheat amphiploids. In addition, this information may be used in breeding programs for regulating the expression of AP2-like genes to modify spike characteristics and to obtain free-threshing plants.
Methods
Plant material
Plants used in this study were from the germplasm collection of the Instituto de Agricultura Sostenible (CSIC, Cordoba, Spain), and included H. chilense accessions H1, H11 and H208 (2n = 2x = 14; HchHch), H. vulgare cv Betzes (H106) (2n = 2x = 14; HH), Triticum durum accession T22 (2n = 4x = 28; AABB), T. aestivum cv Bobwhite (2n = 6x = 42; AABBDD) and hexaploid tritordeum accession HT22 (2n = 6x = 42; AABBHchHch) exhibiting the non-free threshing phenotype derived from the cross between H1 and T22. In addition, two free-threshing lines of hexaploid tritordeum obtained by chromosome substitution [36] were used: HT374 (5D/5Hch) and HT382 (1D/1Hch, 2D/2Hch). Plants were grown in a greenhouse with supplementary lights providing a day/night regime of 12/12 h at 22/16°C.
RNA isolation
Tissues for RNA extractions were collected, immediately frozen by immersion in liquid nitrogen and stored at -80°C. RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, and treated with TURBO DNase (RNase-Free; Ambion, Warrington, UK) to eliminate any DNA contamination. The resulting RNA was stored at -80°C.
Rapid amplification of 5' and 3' cDNA ends (5' and 3' RACE PCR)
The SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) was used for both 5'- and 3'- rapid amplification of cDNA ends. Four nested specific primers, two forward and two reverse (Table 3), were designed using the H. vulgare cv. Forester AP2-like protein mRNA sequence [GenBank: AY069953] as template and were used in combination with the primers provided by the kit. The RACE PCR products were cloned into pGEMT Easy vector (Promega, Madison, WI) and introduced into Escherichia coli (DH5α) competent cells by transformation. The resulting plasmid was isolated, purified using the Perfectprep Plasmid Mini Kit (Eppendorf, Hamburg, Germany), and sequenced.
Full-length open reading frame isolation
The 3' RACE PCR sequences were used in combination with the AP2 sequence from H. vulgare cv. Forester [GenBank: AY069953] to design the primers AP2F4 and AP2newR (Table 3) to amplify the full open reading frame (ORF) of AP2-like gene from H. chilense lines H11, H208 and H. vulgare line H106. cDNA was synthesized using total RNA isolated from immature spikes of above lines using a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Invitrogen. Carlsbad, CA) in combination with oligo (dT)12–18 and random nonamers (Amersham Biosciences, Amersham, UK) according to the manufacturer's instructions. Full ORF was amplified by PCR using the following conditions: cDNA obtained from 50 ng of total RNA, 2 mM MgCl2, 0.2 mM dNTP, 0.2 μM of each primer, 1× CERTAMP buffer and 1 unit of CERTAMP Enzyme Mix (BIOTOOLS, Madrid, Spain) in a final volume of 25 μl. Cycling conditions were: 94°C 3 min, 35 cycles of 94°C 30 sec, 65°C 1 min and 72°C 2 min; and a final extension cycle of 72°C 7 min. PCR product was purified using the GFX PCR DNA Purification Kit (Amersham Biosciences, Amersham, UK) and sequenced.
Edge-to-edge genomic DNA isolation
Genomic DNA was isolated from leaves using the DNAzol reagent (Invitrogen. Carlsbad, CA) according to the manufacturers' instructions. Primers used for amplification were AP2F4 and AP2newR (Table 3). PCR conditions for edge-to-edge genomic amplification were 50 ng of genomic DNA, 2 mM MgCl2, 0.2 mM dNTP, 0.2 μM of each primer, 1× CERTAMP buffer and 1 unit of CERTAMP Enzyme Mix (BIOTOOLS, Madrid, Spain) in a final volume of 25 μl. Cycling conditions were the following: 94°C 3 min, 35 cycles of 94°C 30 sec, 65°C 1 min and 72°C 4 min; and a final extension cycle of 72°C 7 min. PCR products were run in a 1% agarose gel and gel-purified using the QUIAquick Gel Extraction Kit (QUIAGEN Inc., Valencia, CA). Fragments were cloned into pGEMT Easy vector (Promega, Madison, WI) and introduced into E. coli (DH5α) competent cells by transformation. The resulting plasmid was isolated, purified using the Perfectprep Plasmid Mini Kit (Eppendorf, Hamburg, Germany), and sequenced. Three internal primers (F3APT2, F4APT2 and R5APT2) were designed and, in combination with the AP2F4 and AP2newR, used for the complete sequencing (Table 3).
Quantitative real time PCR (qRT-PCR)
Fully emerged spikes of H. chilense (H1), H. vulgare cv Betzes (H106), tritordeum (HT22, HT374 and HT382), T. durum (T22) and T. aestivum cv Bobwhite (BW208). The scale in cm is represented on the right.
qRT-PCR was carried out using the SYBR green dye marker on the ABI Prism 7000 (Applied Biosystems, Warrington, UK). qRT-PCR conditions were: cDNA obtained from 40 ng of total RNA, 0.4 μM of each primer and 1× SYBR Green Master Mix in a final volume of 25 μl. Two sets of primers were used for the specific amplification of part of the AP2-like gene from wheat (AP2*F2/AP2Ta*R2) and cultivated and wild barley (AP2*F2/AP2Hch*R2). The wheat actin mRNA [GenBank: AB181991] was used as reference gene using primers ActinF4 and ActinR4 (Table 3). Three replications of each reaction were performed with three biological samples for each tissue sample. Cycling conditions for qRT-PCR were the following: 95°C for 10 min, 40 cycles of 95°C for 30 sec and 60°C for 1 min. Primers efficiency was determined for all the genotypes. The mean and standard error for all replications were calculated for each point. Quantitative data generated were firstly analyzed using ABI Prism 7000 software following the steps described by Nolan et al. [37]. Expression data were then standardized using the Microsoft Excel Qgene template as described in Muller et al. [38].
Bioinformatic analyses
Primer design was made with the Primer3Plus on-line application [39]. Other analyses and bioinformatics designs were performed with the Vector NTI 9.1.0 suite (Invitrogen, Carlsbad, CA). DNA and peptide-sequence similarities were determined by searches through the GenBank database, using the program BLAST (basic local alignment search tool) [40] on the website [41].
Declarations
Acknowledgements
The authors acknowledge funding by the Spanish C.I.C.Y.T. (project AGL2007-65685-C02-01/AGR). Javier Gil-Humanes also acknowledges the financial support from the I3P Program from the C.S.I.C., co-financed by the European Social Fund. Technical assistance by Ana García is also acknowledged. The authors thank Dr. Paul Lazzeri for critical review of the manuscript and English editing.
Authors’ Affiliations
References
- Alvarez JB, Ballesteros J, Arriaga HO, Martin LM: The rheological properties and baking performances of flours from hexaploid tritordeums. J Cereal Sci. 1995, 21 (3): 291-299. 10.1006/jcrs.1995.0032.View ArticleGoogle Scholar
- Atienza SG, Avila CM, Ramirez MC, Martin A: Application of near infrared reflectance spectroscopy to the determination of carotenoid content in tritordeum for breeding purposes. Aust J Agric Res. 2005, 56 (1): 85-89. 10.1071/AR04154.View ArticleGoogle Scholar
- Atienza SG, Ballesteros J, Martin A, Hornero-Mendez D: Genetic variability of carotenoid concentration and degree of esterification among tritordeum (x Tritordeum Ascherson et Graebner) and durum wheat accessions. J Agric Food Chem. 2007, 55 (10): 4244-4251. 10.1021/jf070342p.PubMedView ArticleGoogle Scholar
- Alvarez JB, Broccoli A, Martin LM: Variability and genetic diversity for gliadins in natural populations of Hordeum chilense Roem. et Schult. Genet Resour Crop Ev. 2006, 53 (7): 1419-1425. 10.1007/s10722-005-5805-5.View ArticleGoogle Scholar
- Atienza SG, Gimenez MJ, Martin A, Martin LM: Variability in monomeric prolamins in Hordeum chilense. Theor Appl Genet. 2000, 101 (5–6): 970-976. 10.1007/s001220051569.View ArticleGoogle Scholar
- Atienza SG, Ramirez CM, Hernandez P, Martin A: Chromosomal location of genes for carotenoid pigments in Hordeum chilense. Plant Breeding. 2004, 123 (3): 303-304. 10.1111/j.1439-0523.2004.00918.x.View ArticleGoogle Scholar
- Martin A, Rubiales D, Cabrera A: A fertile amphiploid between a wild barley (Hordeum chilense) and crested wheatgrass (Agropyron cristatum). Int J Plant Sci. 1999, 160 (4): 783-786. 10.1086/314159.View ArticleGoogle Scholar
- Mackey J: Species relationship in Triticum. Proceedings of the 2nd International Wheat Genetics Symposium: 1963, Lund; Hereditas.volume 2. issue Suppl Edited by: MacKey J. Berlingska Boktryckeriet Lund; 1966:237-276.Google Scholar
- Mackey J: Neutron and X-Ray experiments in wheat and a revision of the speltoid problem. Hereditas. 1954, 40 (1–2): 65-180.Google Scholar
- Muramatsu M: Dossage effect of spelta gene q of hexaploid wheat. Genetics. 1963, 48 (4): 469PubMedPubMed CentralGoogle Scholar
- Jantasuriyarat C, Vales MI, Watson CJW, Riera-Lizarazu O: Identification and mapping of genetic loci affecting the free-threshing habit and spike compactness in wheat (Triticum aestivum L.). Theor Appl Genet. 2004, 108 (2): 261-273. 10.1007/s00122-003-1432-8.PubMedView ArticleGoogle Scholar
- Singh MP: Some radiation induced changes at Q Locus in bread wheat (Triticum Aestivum L). Caryologia. 1969, 22 (2): 119View ArticleGoogle Scholar
- Kato K, Miura H, Sawada S: QTL mapping of genes controlling ear emergence time and plant height on chromosome 5A of wheat. Theor Appl Genet. 1999, 98 (3–4): 472-477. 10.1007/s001220051094.View ArticleGoogle Scholar
- Kato K, Sonokawa R, Miura H, Sawada S: Dwarfing effect associated with the threshability gene Q on wheat chromosome 5A. Plant Breeding. 2003, 122 (6): 489-492. 10.1111/j.1439-0523.2003.00886.x.View ArticleGoogle Scholar
- Kerber ER, Rowland GG: Origin of free threshing character in hexaploid wheat. CanJ Genet Cytol. 1974, 16 (1): 145-154.View ArticleGoogle Scholar
- Simons KJ, Fellers JP, Trick HN, Zhang ZC, Tai YS, Gill BS, Faris JD: Molecular characterization of the major wheat domestication gene Q. Genetics. 2006, 172 (1): 547-555. 10.1534/genetics.105.044727.PubMedPubMed CentralView ArticleGoogle Scholar
- Riechmann J, Meyerowitz EM: The AP2/EREBP family of plant transcription factors. Biol Chem. 1998, 379 (6): 633-646.PubMedGoogle Scholar
- Irish V, Sussex IM: Function of the APETALA-1 gene during Arabidopsis floral development. Plant cell. 1990, 2 (8): 741-753. 10.1105/tpc.2.8.741.PubMedPubMed CentralView ArticleGoogle Scholar
- Bowman J, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR: Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development. 1993, 119 (3): 721-743.Google Scholar
- Komaki M, Okada K, Nishino E, Shimura Y: Isolation and characterization of novel mutants of Arabidopsis thaliana defective in flower development. Development. 1988, 104 (2): 195Google Scholar
- Bowman J, Smyth DR, Meyerowitz EM: Genes directing flower development in Arabidopsis. Plant cell. 1989, 1 (1): 37-52. 10.1105/tpc.1.1.37.PubMedPubMed CentralView ArticleGoogle Scholar
- Jofuku K, Denboer BGW, Vanmontagu M, Okamuro JK: Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant cell. 1994, 6 (9): 1211-1225. 10.1105/tpc.6.9.1211.PubMedPubMed CentralView ArticleGoogle Scholar
- Drews GN, Bowman JL, Meyerowitz EM: Negative regulation of the Arabidopsis homeotic gene AGAMOUS by the APETALA2 product. Cell. 1991, 65 (6): 991-1002. 10.1016/0092-8674(91)90551-9.PubMedView ArticleGoogle Scholar
- Elliott RC, Betzner AS, Huttner E, Oakes MP, Tucker WQJ, Gerentes D, Perez P, Smyth DR: AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell. 1996, 8 (2): 155-168. 10.1105/tpc.8.2.155.PubMedPubMed CentralView ArticleGoogle Scholar
- Klucher KM, Chow H, Reiser L, Fischer RL: The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2. Plant Cell. 1996, 8 (2): 137-153. 10.1105/tpc.8.2.137.PubMedPubMed CentralView ArticleGoogle Scholar
- Mizukami Y, Fischer RL: Plant organ size control: AINTEGUMENTA regulates growth and cell numbers during organogenesis. Proc Natl Acad Sci USA. 2000, 97 (2): 942-947. 10.1073/pnas.97.2.942.PubMedPubMed CentralView ArticleGoogle Scholar
- Mizukami Y: A matter of size: Developmental control of organ size in plants. Curr Opin Plant Biol. 2001, 4 (6): 533-539. 10.1016/S1369-5266(00)00212-0.PubMedView ArticleGoogle Scholar
- Aukerman MJ, Sakai H: Regulation of flowering time and floral organ identity by a microRNA and its APETALA2- like target genes. Plant Cell. 2003, 15 (11): 2730-2741. 10.1105/tpc.016238.PubMedPubMed CentralView ArticleGoogle Scholar
- Chen X: A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science. 2004, 303 (5666): 2022-2025. 10.1126/science.1088060.PubMedView ArticleGoogle Scholar
- Zubay G, Doty P: Isolation and properties of deoxyribonucleoprotein particles containing single nucleic acid molecules. J Mol Biol. 1959, 1 (1): 1-20. 10.1016/S0022-2836(59)80002-4.View ArticleGoogle Scholar
- Chelsky D, Ralph R, Jonak G: Sequence requirements for synthetic peptide-mediated translocation to the nucleus. Mol Cell Biol. 1989, 9 (6): 2487-2492.PubMedPubMed CentralView ArticleGoogle Scholar
- Dingwall C, Laskey RA: Protein import into the cell nucleus. Annu rev cell biol. 1986, 2: 367-390. 10.1146/annurev.cb.02.110186.002055.PubMedView ArticleGoogle Scholar
- Tang M, Li G, Chen M: The phylogeny and expression pattern of APETALA2-like genes in rice. J Genet Genom. 2007, 34 (10): 930-938. 10.1016/S1673-8527(07)60104-0.View ArticleGoogle Scholar
- Huskins CL: Fatuoid, speltoid and related mutations of oats and wheat. Bot Rev. 1946, 12 (8): 457-514. 10.1007/BF02861422.View ArticleGoogle Scholar
- Hernandez P, Dorado G, Prieto P, Gimenez MJ, Ramirez MC, Laurie DA, Snape JW, Martin A: A core genetic map of Hordeum chilense and comparisons with maps of barley (Hordeum vulgare) and wheat (Triticum aestivum). Theor Appl Genet. 2001, 102 (8): 1259-1264. 10.1007/s001220000514.View ArticleGoogle Scholar
- Atienza SG, Martin AC, Martin A: Introgression of wheat chromosome 2D or 5D into tritordeum leads to free-threshing habit. Genome. 2007, 50 (11): 994-1000. 10.1139/G07-081.PubMedView ArticleGoogle Scholar
- Nolan T, Hands RE, Bustin SA: Quantification of mRNA using real-time RT-PCR. Nat Protocols. 2006, 1 (3): 1559-1582. 10.1038/nprot.2006.236.PubMedView ArticleGoogle Scholar
- Muller PY, Janovjak H, Miserez AR, Dobbie Z: Processing of gene expression data generated by quantitative real-time RT-PCR. BioTechniques. 2002, 32 (6): 2-7.Google Scholar
- Primer3Plus. [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi].
- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol. 1990, 215 (3): 403-410.PubMedView ArticleGoogle Scholar
- Basic Local Alignment Search Tool. [http://www.ncbi.nlm.nih.gov/BLAST/].
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.