Skip to main content

Table 4 A list of primer sets for 44 EST microsatellite markers in the Stenogyne EST library. 35 primer sets were tested initially with Stenogyne rugosa (unigene IDs with bold text), 30 of which gave clear PCR products. Of these 30 primer pairs, 24 (marked with an asterix) gave positive amplification for four Hawaiian mint accessions.

From: An expressed sequence tag (EST) library from developing fruits of an Hawaiian endemic mint (Stenogyne rugosa, Lamiaceae): characterization and microsatellite markers

Unigene ID Forward primer sequence (5'-3') Reverse primer sequence (5'-3') Expd. product size (bp)
260553* CCCTCCGACGACACTAAA CGACAATCTGGCAAACAG 322
260567* GAAAGTGAAAGCAGCAGATAC ATGTGGAGGAATGATGACAC 275
260570* GTGGGAGAAACCTGAAGAG TGTATTGACTGCCCTGATG 109
260579 TTTCTCTTCTCTCACTCACTTTC TGATTACACCACTTCTATTGTT 226
260619* ATCTTCCCTTCCTCAAATC TCATCATCGTCGTCTTCTTC 325
260625 GGAAGTAGAAGCAGAAGAAGG GAGTTAGCATTGAAGGAAACA 345
260641* CAAGAATCAAACAGACCAGAC CAGGGAAGGTAAAGCAATC 375
260657* TAAGTCTCATAGCAAGCGAAC TATTCTACATCCCTCACACCC 128
260658 CACACCAAATCGTCAAATC CTTCCCTCTATTCTCCAAACT 239
260658 CACACCAAATCGTCAAATC CTTCCCTCTATTCTCCAAACT 239
260664* AACATTCACCAACCACCTT GTCCCAGAGCACCTTCTT 186
260670* AAGAAAGAGAAGAAGGATGGT AGAAGGGTTTGAGTGGATG 169
260691* TCCGAAATCATACTCATAAA GGGCGATGTGCTTAGTTC 258
260708* ACCAGGAGGAAGATTGGA TATGATTGGAGAGGTGAGATG 217
260711 GCACGAGGCAGTAATCTTT GCAAATAATCACCACAGTTCTT 395
260714* AATAGAGATTGGAGAGAAGCA CGACACAAACGAAACATC 321
260715* AAATCTGGGCTACTCAAACA GGTCAGTCTTCTGTGAACCA 190
260720* ACGAGGTTTAGAAGCAAAGT GTTGGAGTATCTGGGAAGAAG 159
260754* CACGAGGATTTACTGCTTCA ACAAGGACATAGTTGGAGGTT 314
260776* ACTGTTGTTGATGTTCCC TCATTCTTCCACCATTTGA 257
260779 CCTTCACCTGCTCTTCATAC TCTTTACTCTTCTCTTTCTGACC 219
260781 GCACGAGGACAAGAAATAGA CGCTGCCTGAAGATGAGA 226
260802* GAAAGTGAAAGCAGCAGATAC GATGTGGAGGATGATGACAC 270
260810* GCTTCCTTCTCTTCCCAA ACTGGTTCCGATTCTGTATG 220
260811* CAGTTGGGAAAGATAAACAGA GGAACACAAGGAGAGGATAAA 380
260853 CGGATTGCTGATTTACTGA GAGATTCAAACGAACACGA 174
260883* AGAAGGAGCGGGAGGTTT TAATAATCTTGCGTCGGAG 278
260903 ACGAGAATGGGATAAAGAAAC ATCGGTCGGTTGAGTAAGA 362
260907 CATTGGCTGGTCATAAGG TAGTAGTGTTTGGGAGGATTG 210
260915* CATCGGTTAGAAACACAAGAA CAAACAAAGAGAAGCCTACC 305
260925 ATAAATCTCTCCCTCCTCTCC TTCTTCGTCGTTCCTCCT 400
260939* CGAATGTAGAAAGATAAAGGAG CTGGACAAGTAAACGGTAGG 221
260940* GTTACATACCGTTCCCACC TACCCTCTCTCATCCTCAAC 394
260971 TGTTGGAGTGTAAAGTTGGTT GAGTTGTTGTTGCTGACGA 380
260986 AGAGACTGTGAGTGAGCAGG CCATAACATCAATACCATCCA 374
260996 CCAGGGTGAACAATGAAG TTCTACGGTTTGAGGGAAG 165
261018 ACTGGAGGAAGAAAGCAATAC TTTACCAAATGAACCAATCC 236
261039* CATAGTAACAGATGAACCCTAA ATCAACCCGTGAAGAAACC 220
261062 TTCTCTCACTCAATCCTGAAA TACAACGCAATGACCGATAC 299
261064* CAACGCACACACTATGCTTC TATTCTGGGTAGGACCATTC 228
261094 GCAGTGATGGCACAGTTAG CGAGAAGTCGGCAGTTCA 317
261109 ATTCATTCATTCCGCTACAC CAGAGGGCTGCTAAGATG 157
261109 ATTCATTCCGCTACACAAA GGTTTATCCGCTGGTGGT 366
261131 ACGGATGGACTTAGGACTTT TTTGAGATTTGAGTAGTTTGAGA 241