Skip to main content

Table 3 Sequences of microsatellite primer pairs for each locus, linkage group (LG) in M. truncatula and reference. Sequences are given in the 5' to 3' direction (H for T. Huguet, unpubl.; S for S. Santoni, unpubl.)

From: Construction of two genetic linkage maps in cultivated tetraploid alfalfa (Medicago sativa) using microsatellite and AFLP markers

Locus Left Right LG Reference
AFct32 TTTTTGTCCCACCTCATTAG TTGGTTAGATTCAAAGGGTTAC   [35]
AFct45 TAAAAAACGGAAAGAGTTGGTTAG GCCATCTTTTCTTTTGCTTC   [35]
MTLEC2A CGGAAAGATTCTTGAATAGATG TGGTTCGCTGTTCTCATG 3 [35]
MAW208206 CTTATGTGCGTGGTATTTCC AGCTAAACCAACTACCTTTG 4 S
MAA660456 GGGTTTTTGATCCAGATCTT AAGGTGGTCATACGAGCTCC 4 [34]
MAA660870 GTACATCAACAACTTTCTCCT ATCAACAAAATTCATCGAAC   S
MAL368684 GACCCTAATAACCAACTCCA CCGTTACCGTCACTGTCGT 1 S
FMT13 GATGAGAAAATGAAAAGAAC CAAAAACTCACTCTAACACAC 1 S
MTR58 GAAGTGGAAATGGGAAACC GAGTGAGTGAGTGTAAGAGTGC 1 [34]
MAL369471 ATTCACACAAACCCATCTTC AAACCCTTAGCACCGACA 1 S
AI974357 ATCTCAATTCCCCAACTTGC TCTCCTTCACCCATCTTTGC 3 H
B14B03 GCTTGTTCTTCTTCAAGCTC ACCTGACTTGTGTTTTATGC 5 H
B21E13 GCCGATGGTACTAATGTAGG AAATCTTGCTTGCTTCTCAG 2 H
E318681 ACCATCAACACCAACAGCAG TGCTACTTCCGCTTTGTTCA 5 H
ENOD20 CGAACTTCGAATTACCAAAGTCT TTGAGTAGCTTTTGGGTTGTC 8 H
MTIC7 ACCACTTCTCCATCCATCCA AGCTTGCTGCATGAGTGCT   H
MTIC12 TTCCTCTTTTGACTCATCACCA CAACAACATGTTCATGCTTAGAAAC 2 H
MTIC14 CAAACAAACAACACAAACATGG CCCATTGATTGGTCAAGGTT 6 H
MTIC19 TCTAGAAAAAGCAATGATGTGAGA TGCAACAGAAGAAGCAAAACA 2 H
MTIC21 GGTGATTGACTGTGGTGTCG ATCCGGTCTCCCAGGTTCTA 2 H
MTIC27 CGATCGGAACGAGGACTTTA CCCCGTTTTTCTTCTCTCCT 2 H
MTIC35 GAAGAAGAAAAAGAGATAGATCTGTGG GGCAGGAACAGATCCTTGAA 7 H
MTIC48 TTTTTGTTAGTTTGATTTTAGGTG GCTACAAAGTCTTCTTCCACA 5 H
MTIC51 AGTATAGTGATGAAGTGGTAGTGAACA ACAAAAACTCTCCCGGCTTT 3 H
MTIC58 CATCATTAACAACAACGGCAAT TGCAAACACAGAACCGAAGA 5 H
MTIC64 CCCGTTCTTTTATGTTGTGG AACAAACACAATGGCATGGA 1 H
MTIC77 TCTTCATCGCTTTCTTCTATTTCA GCCGTATGGTGTTGTTGATG 3 H
MTIC79 AAAATCCAAAGCCCTATCACA AGCGTGAGATTTTTCCATCG 5 H
MTIC82 CACTTTCCACACTCAAACCA GAGAGGATTTCGGTGATGT 7 H
MTIC84 TCTGAGAGAGAGACAAACAAAACAA GGGAAAAGGTGTAGCCATTG 1 H
MTIC90 TTTTCTTCTTCAAACCCCTAACC GATTATCGTTGAGCGGTGGT 4 H
MTIC93 AGCAGGATTTGGGACAGTTG TACCGTAGCTCCCTTTTCCA 6 H
MTIC94 GCTACAACAGCGCTACATCG CAGGGTCAGAGCAACAATCA   H
MTIC95 AAAGGTGTTGGGTTTTGTGG AGGAAGGAGAGGGACGAAAG   H
MTIC103 TGGGTTGTCCTTCTTTTTGG GGGTGCAGAAGTTTGACCA 8 H
MTIC107 CAAACCATTTCCTCCATTGTG TACGTAGCCCCTTGCTCATT 1 H
MTIC124 TTGTCACGAGTGTTGGAATTTT TTGGGTTGTCAATAATGCTCA 3 H
MTIC131 AAGCTGTATTTCTGATACCAAAC CGGGTATTCCTCTTCCTCCA 3 H
MTIC134 GCAGTTCGCTGAGGACTTG CAATTAGAGTCTACAGCCAAAAACT 6 H
MTIC135 GCTGACTGGACGGATCTGAG CCAAAGCATAAGCATTCATTCA 8 H
MTIC145 CCAAAAGGGGCAATTTTCTT GCATAATTCAATACTTGATCCATTTC 2 H
MTIC153 TCACAACTATGCAACAAAAGTGG TGGGTCGGTGAATTTTCTGT 6 H
MTIC169 TCAAAACCCTAAAACCCTTTCTC GCGTGCTAGGTTTGAGAGGA 3 H
MTIC183 AAATGGAAGAAAGTGTCACG TTCTCTTCAAGTGGGAGGTA 7 H
MTIC185 AGATTTCAATTCTCAACAACC TCTATGATGGATACGATACGG 8 H
MTIC188 GGCGGTGAAGAAGTAAACGA AATCGGAGAAACACGAGCAC 8 H
MTIC189 CAAACCCTTTTCAATTTCAACC ATGTTGGTGGATCCTTCTGC 3 H
MTIC210 CCAAACTGGCTGTGTTCAAA GCGGTAAGCCTTGCTGTATG 2 H
MTIC230 GTAAGCGCCTGCTTGGACT GAGATTCTGCCAAAATGCAA 2 H
MTIC232 TAAGAAAGCAGGTCAGGATG TCCACAAATGTCTAAAACCA 7 H
MTIC233 GCGTAACGTAACAACATTCA AAGGAACAATCCCAGTTTTT 1 H
MTIC237 CCCATATGCAACAGACCTTA TGGTGAAGATTCTGTTGTTG 3 H
MTIC238 TTCTTCTTCTAGGAATTTGGAG CCTTAGCCAAGCAAGTAAAA 5 H
MTIC247 TTCGCAGAACCTAAATTCAT TGAGAGCATTGATTTTTGTG 1 H
MTIC248 TATCTCCCTTCTCCTTCTCC GGATTGTGATGAAGAAATGG 8 H
MTIC249 TAGGTCATGGCTATTGCTTC GTGGGTGAGGATGTGTGTAT   H
MTIC250 GCCTGAACTATTGTGAATGG CGTTGATGATGTTCTTGATG 6 H
MTIC251 GCGATGCTATTGAGAAAACT AAATAAACCCAAAGGACTCG 8 H
MTIC258 CACCACCTTCACCTAAGAAA TGAAATTCACATCAACTGGA 1 H
MTIC272 AGGTGGATGGAGAGAGTCA TCATGAATAGTGGCACTCAA 3 H
MTIC273 TGTTAGCAACTTTGTGATGG TCCATTACAATACCCAGAGG 7 H
MTIC278 CTTACCCTCCACTGCTACTG CGCATATAACAGAGGGTTTC 2 H
MTIC289 GCTGGTGTCAAAGAGGTCTA AGATTTGAAACTGCCCTACA   H
MTIC299 AGGCTGTTGTTACACCTTTG TCAAATGCTTAAATGACAAAT 8 H
MTIC304 TTGGGCTTAATTTGACTGAT AGCGTAAAGTAAAACCCTTTC 2 H
MTIC314 TCTAATCCCAACAACACTCTT GAAGAAGAAGCCATAGTGTGA 1 H
MTIC318 TCAACCAACTCAATGCCACT TTGTTGTGAAATGGAAAATGG 7 H
MTIC326 GATCACCCTTTATGGAGTTTGAA CGACTTCAATTGACCCCCTA 4 H
MTIC331 CCCTCTTCTACCTCCTTTCCA GGAAGAGAAGATGGGGGTGT 4 H
MTIC332 CCCTGGGTTTTTGATCCAG GGTCATACGAGCTCCTCCAT 4 H
MTIC338 TCCCCTTAAGCTTCACTCTTTTC CATTGGTGGACGAGGTCTCT 3 H
MTIC339 CCACACAAAACACGCACTCT GGTAGGATTGCCACGACTGT 4 H
MTIC343 TCCGATCTTGCGTCCTAACT CCATTGCGGTGGCTACTCT 6 H
MTIC345 TCCGATCTTGCGTCCTAACT CCATTGCGGTGGCTACTCT   H
MTIC347 TCGGTGTATTTCCGTGTTTG GGTTGAAATTGAAAGAAGAATCG 4 H
MTIC354 AAGTGCCAAAGAACAGGGTTT AACCTACGCTAGGGTTGCAG 2 H
MTIC356 CGGCGATGGAAAATTGATAG CCAATACAAACTTTGCGTGAGA 8 H
MTIC365 ATCGGCGTCTCAGATTGATT CGCCATATCCAAATCCAAAT 2 H
MTIC432 TGGAATTTGGGATATAGGAA GGCCATAAGAACTTCCACTT 7 H
MTIC441 CTTCCTTATCATCGCTTCC CAGAGATTGAGAATCGAGAAG   H
MTIC446 ATAACTGGCTGAACAAATGC TCTCCTTCCACCCTCTATG 7 H
MTIC447 TCTTGTTGTATCCTCCGAAC TCCTGAGTTGTAGAGTGAGTGA 1 H
MTIC451 GGACAAAATTGGAAGAAAAA AATTACGTTTGTTTGGATGC 2 H
MTIC452 CTAGTGCCAACACAAAAACA TCACAAAAACTGCATAAAGC 2 H
MTIC470 GGTTCGTGTATTTGTTCGAT CCCTTCACAGAATGATTGAT 7 H
MTIC471 ATCAGGTGATGATTGGTTTT CCAACCATCTTTGTTTCCTA   H
MTIC475 GGATTGAAATGCACTCTCTC TTAATAAACGCCGCTCCT 3 H