Skip to main content

Table 7 Primer pairs used in the Principal Coordinates Analysis to compare the genetic diversity and affinities of Hs compared with a representative sample of commercial and wild diploid palms (listed in Table 6).

From: Production of haploids and doubled haploids in oil palm

No Primer Forward (5'-3') Reverse (5'-3')
1 1996 CACTGGGGTCATCTTCATCT TCGTTCTCTTTCCTTTTGTC
2 2215 GAACTTGGCGTGTAACT TGGTAGGTCTATTTGAGAGT
3 2427 GAAGGGGCATTGGATTT CAGGTGACCAAGTGTAAT
4 2569 TAGCCGCACTCCCACGAAGC CCAGAATCATCAGACTCGGACAG
5 2595 TCAAAGAGCCGCACAACAAG ACTTTGCTGCTTGGTGACTTA
6 2600 GGGGATGAGTTTGTTTGTTC GGCAACATGAAGGTAAG
7 3282 GTAACAGCATCCACACTAAC GCAGGACAGGAGTAATGAGT
8 3298 GACTACCGTATTGCGTTCAG TTTATCAGGAGTTTTTGTTTGAGAG
9 3311 AATCCAAGTGGCCTACAG TCCCTACAATAGCCATCTC
10 3321 CAAGGAGGAGCAGGTGAG TACGGCCTCGGTTCTACAC
11 3399 AGCCAATGAAGGATAAAGG CCACTTAGAGGTAAAACAACAG
12 3400 CAATTCCAGCGTFAFTATAG AGTGGCAGTGGAAAAACAGT
13 3433 GGTTCAATGGCATACAT ACTCCCCTCTTTGACAT
14 3538 TCAAGCCACATCCTAACTAC CTCATAGCCTTTGTTGTGT
15 3544 AGCAGGGCAAGAGCAATACT TTCAGCAGCAGGAAACATC
16 3546 GCCTATCCCCTGAACTATCT TGCACATACCAGCAACAGAG
17 3574 AGAGACCCTATTTGCTTGAT GACAAAGAGCTTGTCACAC
18 3711 GTCTCATGTGGCTACCTCTC GCTAGGTGAAAAATAAAGTT
19 3819 CCTCCTTTGGAATTATG GTGTTTGATGGGACATACA
20 219 TTTGCTCGGCGGATACAT GGAGGGCAGGAACAAAAAGT
21 257 GCAGCTAGTCACCTGAAC GACGAGACTGGAAAGATG
22 782 CGTTCATCCCACCACCTTTC GCTGCGAGGCCACTGATAC
23 783 GAATGTGGCTGTAAATGCTGAGTG AAGCCGCATGGACAACTCTAGTAA
24 882 TTGATCTTAGACATAACATACTGTA AAAGCGCGTAATCTCATAGT
25 894 TGCTTCTTGTCCTTGATACA CCACGTCTACGAAATGATAA
26 3213 GCTCTTTGTATTTCCTGGTTC AGCAGCAAACCCTACTAACT
27 3691 GCATCATTGGACTATCATACC TTGTGAACCAGGGAACTATC
28 vs1 GAGATTACAAAGTCCAAACC TCAAAATTAAGAAAGTATGC
  1. All primers except VS1 were taken from Billotte et al. [27].