Skip to main content

Table 2 Sequences of primers used for semi-quantitative RT-PCR

From: Characterisation of the Vitis viniferaPR10 multigene family

Gene GenBank Forward primer 5'→3' Reverse primer 5'→ 3'
Actin AF369525 TGCTATCCTTCGTCTTGACCTTG GGACTTCTGGACAACGGAATCTC
VvPR10.1 AJ291705 GAAATCATACAAGGAGAGGGAGGC GCCAAACTTATTGAGACTGATAGGTG
VvPR10.2 AJ291704 CGATCACAGTGTAGCGGAATGAGAAT AAGCTATCAAGTGCGTGGAAGTCATT
VvPR10.3 EU379313 GAAATCCTACAAGGACAGGGAGGT CGGCCTTGGTGTGGTACTTTT
VvPR10.4 - ATCCTTCCCCAAGCTATCAAG GATTTGCCAAGAGGTAAGCC
VvPR10.5 - ATCCTTGACTCTGATAACCTCA ATGATATGAGACAAAGGAGTTTC
VvPR10.6 - GTCCTTGATGTTGATAACCTC AAGCCAAGCCTTTTAACTG
VvPR10.7 - ATCGTCCCTCAGGCCATTA AAGTGATTAAGTGGAGGAGAAGC
VvPR10.8 - CTCTTGCCCCAGACCATAAG ACATTGGACAACAGAGAAGTGAC
VvPR10.9 - CAGTCAAAAGTACGCGACTCA AAGTATAGGCGCGAGGGTGT
VvPR10.10 - AATCAGTAAAGAGCATCGAGTT AAAGTAATCACAACTCCTCGTC