Skip to main content
Fig. 2 | BMC Plant Biology

Fig. 2

From: QTL mapping for the flag leaf-related traits using RILs derived from Trititrigia germplasm line SN304 and wheat cultivar Yannong15 in multiple environments

Fig. 2

Polyacrylamide gel plots of double-ended anchored primers from the QTL interval between markers 522,975 and 522,687. Note The forward sequence and reverse sequence of the double-ended anchoring primers were GGCACCCGGACATCAGTT and GGGGCTAAGACAAGTCTACCAG, respectively. The red arrows indicate DNA fragments specific to Th. intermedium. M, marker (2 kb ladder); 1, Th. intermedium; 2, SN304; 3, YN15. The groups of the gel were cropped from different parts of the same gel, and the original gel is shown in Additional file 3

Back to article page

BMC Plant Biology

ISSN: 1471-2229

Contact us