Skip to main content

Table 1 Enhansers

From: Development of dual reporter vector system for estimating translational activity of regulatory elements

enhancer Description Reference Sequence Length
AT30 Deletion varinat AT doi:10.1093/nar/gkt864 CTCTAATCACCAGGAGTAAAA 21
AT65 Deletion varinat AT doi:10.1093/nar/gkt864 GAGAGAAGAAAGAAGAAGACG 21
AT100 Deletion varinat AT doi:10.1093/nar/gkt864 CACAAAGAGTAAAGAAGAACA 21
AT208 Deletion varinat AT doi:10.1093/nar/gkt864 ATTATTACATCAAAACAAAAA 21
MsynJ Modificated synthetic enhancer http://www.biomedcentral.com/1472-6750/12/85 ACAGGCGCTATCAATCCGAAGCTAAACCATG 31
SynM Modificated synthetic enhancer http://www.biomedcentral.com/1472-6750/12/85 ACACGCTGGAATTCTAGTATACTTTTCCATG 31
GGR Geranyl-geranyl reductse enhander DOI 10.1007/s11248-013-9757-9 ACAAACTCAAAACACAGAGAACAGAGAGAG AGAGAGAGACTCCATTGTTGAAGTGTGTTC ACTGAACTCCTCCTCAAACAACA 83