Skip to main content

Table 1 Primers used for qRT–PCR analysis and their target genes

From: Physiological mechanism of strigolactone enhancing tolerance to low light stress in cucumber seedlings

Gene name Direction Primer sequence
RBOH F 5′ AAGGTTGCTGTTTATCC 3′
R 5′ AATGGTCTTGAGTTGGG 3′
SS F 5′ CGGTTACTTCGCACAAGATAATG3’
R 5′ CATAACCAGATCACCAGACTCC 3′
SPS F 5’GAGAGGATTCCGGTGCAATATC 3′
R 5′ CAAGAAGACAGGCACTAAGGTAC 3′
APX F 5′ TGCTTTCATCACCATCAA 3′
R 5′ TGTTATGTTCTTGTCTTCCT 3′
GR F 5′ CATGGTGCTGTGAAG 3′
R 5′ TCTTACACCTGTGGCTCTAATG 3′
DHAR F 5’GGCAAAGTTCCCGTTGTTAAAT 3′
R 5′ AAGAGAAGTACCCAAATCCACC 3′
MDHAR F 5′ GCGAGGGAGTTTGTGAAATTG 3’
R 5′ GTATCTCTTCCCTGAGTCTCCT 3’
MAX1 F 5′ CCCATACTCCAAGAGCCATTTA 3’
R 5′ AAGCCTACCACTCAACTTCTG 3’
MAX2 F 5′ ACCAGGAAAAACCATAGACAGAA3’
R 5′ TGACGAGCAGAGGAACGC 3’
MAX3 F 5′ TGCCACCGAAGAGGTTATTG 3’
R 5′ TGGCTAGTTGGTAGAAGCATATC 3’
MAX4 F 5′ GGAGATCGACACCTCGAATAAT 3’
R 5′ CACTCAGCCAAGAGGGTAAA 3’
Actin F 5′ CAGGAATCCACGAAACTACT 3’
R 5′ AGACCCTCCAATCCAAACAC 3’
  1. Note: RBOH respiratory burst oxidase homologue, SS sucrose synthase, SPS sucrose phosphate synthase, APX ascorbate peroxidase, GR glutathione reductase, DHAR dehydroascorbate reductase, MDHAR monnodehydroascorbate, MAX1(CYP711A1) more axillary growth1(P450 monooxygenase), MAX2 more axillary growth2(F-box protein of a SCF complex), MAX3(CCD7) more axillary growth3(carotenoid cleavage dioxygenase7), MAX4(CCD8) more axillary growth4(carotenoid cleavage dioxygenase8); Actin, housekeeping gene