Skip to main content

Table 2 Novel miRNAs identified in the fertile and sterile lines of Brassica napus by high-throughput sequencing

From: Identification of miRNAs and their target genes in genic male sterility lines in Brassica napus by small RNA sequencing

miR_ name Sequence Len Read pre-position pre-len MFE
bna-novel_1-3p CUUCCUCCUAACACCAAUUGAUU 23 67 chrA09:27889716..27889818 102 −34.6
bna-novel_1-5p AUCAAUUGGUUUUAGGUUAAGAAGCC 26 124    
bna-novel_2-3p UGGCAUUGGUAGUAAUGAGUGU 22 190 chrC04:42905032..42905108 76 −26.9
bna-novel_2-5p ACUCAUUACCAUCAGAGCCAC 21 7    
bna-novel_3-3p UCAAUGUUGGCUCAAUUAUGU 21 120 chrC02:22515980..22516065 85 −29.5
bna-novel_3-5p UCAUUGAGUGCAGCGUUGAUGU 22 12    
bna-novel_4-3p AUUAUCGACACUGAUCUCAUC 21 106 chrC08:2975781..2975915 134 −80.8
bna-novel_4-5p UAAGGUCACUGUGGUAAUCC 20 52    
bna-novel_5-3p UCAAUGUUGGCUCAAUUAUG 20 49 chrC09:40959623..40959707 84 −31.6
bna-novel_5-5p UCAUUGAGUGCAGCGUUGAUGU 22 12    
bna-novel_6-5p AAGGACUCUAAUCAGAAAUAUUGG 24 143 chrC06:35249139..35249190 51 −9.9
bna-novel_6-3p AAUGGUCUUAUCUGGAAUCCUUAA 24 11    
bna-novel_7-5p UGCCUGGCUCCCUGUAUACCA 21 83 chrA08:8293061..8293144 83 −32.4
bna-novel_7-3p GUGUAUAGAGUAGUCAAGCAUG 22 2    
bna-novel_8-5p AUCUCUAAUGUAUAACUCCAUUUU 24 24 chrA03:20065617..20065865 248 −95.7
bna-novel_8-3p AAUGGAGUAGAUAUGGAGAUGCCC 24 1    
bna-novel_9-3p UUGGACUGAAGGGAACUCCCU 21 1527 chrA09:14645700..14645869 169 −64.4
bna-novel_9-5p AGAGUUUCCUUAAGUCCAUUC 21 17    
bna-novel_10-5p UAAGAUCUUUGUACUUUCGGG 21 67 chrA10:15442817..15442916 99 −39.8
bna-novel_10-3p CGAAAGUACAAAGAUCUGAAA 21 3    
bna-novel_11-5p AACAGUUGGAUUGGCUCUACGUGG 24 27 chrA09_random:3088720..3089020 300 −65.5
bna-novel_11-3p ACGAUGGAGGACAAAACUGAUGCA 24 2    
bna-novel_12-5p UUUUCAGCAAUCUCUUUUCCAUU 23 44 chrA05_random:416209..416319 110 −29.5
bna-novel_12-3p AUGGGAAAGAUUGUUGAUCAGA 22 6    
bna-novel_13-5p UAAAGUAGAGCUCGGUGACGG 21 1163 chrC03:20992442..20992727 285 −240.3
bna-novel_13-3p GUCACCGAGCUCUACUUUAUA 21 1058    
bna-novel_14-5p UCGCUUCUGUUGAAUAAUUUUGAC 24 22 chrC04:45707769..45708016 247 − 148
bna-novel_14-3p CAAAAUUAUUCAACAGAAGCGAAU 24 23    
bna-novel_15-5p AUAUGAGGGUACAAUAGGAAG 21 137 chrAnn_random:33598332..33598540 208 −139.1
bna-novel_15-3p UAUUGUACCCUCAUAUAUAGC 21 89    
bna-novel_16-3p CUAAGAGAUCUGUAAUAAACAUGC 24 30 chrC04:7124159..7124378 219 −117.5
bna-novel_16-5p AUGUUUAUUGUAGGUCUUUUAGGUU 25 7    
bna-novel_17-5p ACGAACACUGAGUAAUAUCUG 21 15 chrC01_random:3928762..3929012 250 −164.8
bna-novel_17-3p GAUAUUACUCAGUGUUCGUUG 21 13    
bna-novel_18-3p ACACUGCAGUGCACUGUACAUUGC 24 17 chrCnn_random:79954335..79954585 250 −113.8
bna-novel_18-5p GUUGUACAUUGUACACAGCGGUGUAC 26 3    
bna-novel_19-5p UUGCAAACUGAAUUAUGAGUC 21 20 chrA09:30966144..30966235 91 −45.4
bna-novel_19-3p CUCAUAAUUCAGUUUGCAAUC 21 20    
bna-novel_20-5p AAGAUACGGUCUCUUAACUUUUAG 24 259 chrC04_random:3818028..3818149 121 −67.8
bna-novel_20-3p GUUAAUAGACCGUAUCUUAUA 21 13    
bna-novel_21-5p AACGAUCUUGUUUGGUUUUGAAGA 24 18 chrA05:21620032..21620188 156 −82.1
bna-novel_21-3p UUCAAAACCAUACAAGAUCGUUUU 24 24    
bna-novel_22-3p GAUCAUGUUCGUAGUUUCACC 21 445 chrCnn_random:35712007..35712108 101 −47.3
bna-novel_22-5p UGAAGCUGCCAGCAUGAUCU 20 3    
bna-novel_23-3p UUCUUGUGCGUUUAUAGGUAG 21 55 chrA06:23040126..23040236 110 −52.8
bna-novel_23-5p ACCUCUAAAACACACAAGAAGA 22 3    
bna-novel_24-5p UGUUUCGCUGUUACUCAUGC 20 40 chrC02:8973302..8973545 243 −93.1
bna-novel_24-3p AUGAGUAACAGCGAAACAAA 20 26    
bna-novel_25-3p AAACUGUGUGAACUCUCCAUGGAG 24 389 chrC02_random:2214651..2214881 230 −73.8
bna-novel_25-5p CCAUAAAAAGGGUUCACAAAGUAUUU 26 1    
bna-novel_26-3p UUGAUACAUGUAGCUCUUUG 20 2089 chrA03:669098..669269 171 −83.8
bna-novel_26-5p AAGUGCUACCGGUAUCCACGUG 22 840    
bna-novel_27-5p UUAAUCGUUUUGUGACUCUU 20 244 chrA07:19146929..19147018 89 −34.7
bna-novel_27-3p UAGUUACAAAACGAUUAGUGC 21 24    
bna-novel_28-3p AUCAACGUUGGCUCAAUUAUG 21 453 chrA10_random:1861693..1861781 88 −33.2
bna-novel_28-5p UCAUUGAGUGCAGCGUUGAUGU 22 12    
bna-novel_29-3p UCUUGUUACUGAGCUCGACG 20 308 chrA02:7209993..7210285 292 −99.9
bna-novel_29-5p UUCAGCUGGGUACGAGCCACC 21 710    
bna-novel_30-5p AUCUGCAUCGAGUGAACUCUAUGG 24 426 chrCnn_random:65177977..65178226 249 −72.9
bna-novel_30-3p AUGGAAUUCACUGAUGCAGAUGCU 24 7    
bna-novel_31-5p UUCUUGUGGUUGUAGAGUCUUG 22 367 chrA06:4069612..4069740 128 −56.1
bna-novel_31-3p AGACUCUACAACAUCAGAAAC 21 47    
bna-novel_32-5p CGGAUUUUAGCUGCGUAGCUA 21 322 chrAnn_random:44030328..44030409 81 −42.5
bna-novel_32-3p GGCUACGCUGCUGAAUCCGC 20 2    
bna-novel_33-3p UUGUAGAAUUUUGGGAAGGGC 21 289 chrC05_random:138762..138826 64 −32.6
bna-novel_33-5p CCUUCCCAAAAUUCUACAAUU 21 39    
bna-novel_34-5p ACUUUGAAACUUUGAUCUAGA 21 5292 chrC06:5179422..5179524 102 −42.4
bna-novel_34-3p UAGAUCAAAGCUUUAAUGU 19 20    
bna-novel_35-3p UUUUCGAUCUGUAAAUUU 18 4 chrA03:11978303..11978381 78 −30.5
bna-novel_35-5p CAUUUACAGAUCGAAGACAUU 21 3    
  1. miR_name miRNA name, Len length of mature miRNA, pre-position the position of miRNA precursor sequences in chromosomes of Brassica napus, pre-len length of miRNA precursor sequences, MFE minimum folding free energy, Read the total read count of all the small RNA libraries