Skip to main content

Table 1 Specific primers and internal reference primers

From: Transcriptomics of different tissues of blueberry and diversity analysis of rhizosphere fungi under cadmium stress

Primer name Sequence (5ʹ-3ʹ) Description
DN28053_c0_g3-F TGGGCTCTATGTAAATCTCCGTAT Root DN28053 c0 g3 qRT-PCR Primer
DN28053_c0_g3-R CAACTTGCTTATTCCACCATACTCAT Root DN28053 c0 g3 qRT-PCR Primer
DN43627_c1_g2-F GGGATTTGTTTAGGGTAGTTGAAGG Root DN43627 c1 g2 qRT-PCR Primer
DN43627_c1_g2-R TGAGACCAATGTCCCAACCACT Root DN43627 c1 g2 qRT-PCR Primer
DN32241_c0_g1-F CAAAGCCTCCTATGGGTCTGA Root DN32241 c0 g1 qRT-PCR Primer
DN32241_c0_g1-R TATGACCGTGGCAAGGTCTG Root DN32241 c0 g1 qRT-PCR Primer
DN21228_c0_g1-F TTTCGGACATCCAAAGACAGC Root DN21228 c0 g1 qRT-PCR Primer
DN21228_c0_g1-R GAAGAGTGCCTGTATGAGGGTTG Root DN21228 c0 g1 qRT-PCR Primer
DN28398_c1_g2-F ATGAATGGAGGGCTTGGAGAA Root DN28398 c1 g2 qRT-PCR Primer
DN28398_c1_g2-R CAGCCCAAGTCAGCAATGTTT Root DN28398 c1 g2 qRT-PCR Primer
DN29181_c0_g2-F CGGGTCAGTTTACGAGCAGAA Stem DN29181 c0 g2 qRT-PCR Primer
DN29181_c0_g2-R GCACATACGCCATCTTCTTCG Stem DN29181 c0 g2 qRT-PCR Primer
DN35069_c1_g1-F GTGGACCCAAAGCAGCACAAG Stem DN35069 c1 g1 qRT-PCR Primer
DN35069_c1_g1-R GCCAGGTTGGTAATCTGAGGG Stem DN35069 c1 g1 qRT-PCR Primer
DN39782_c0_g2-F GGTCGCTTTCCTCCACTCA Stem DN39782 c0 g2 qRT-PCR Primer
DN39782_c0_g2-R ACGCCAAACTCAAAGCCAGA Stem DN39782 c0 g2 qRT-PCR Primer
DN35079_c1_g3-F CCCCACATTAGCGGTGTTCAA Stem DN35079 c1 g3 qRT-PCR Primer
DN35079_c1_g3-R CTTCACGTCCAAAACACTTAGCTTC Stem DN35079 c1 g3 qRT-PCR Primer
DN36954_c0_g2-F GTGCCCTAACTTTGGGATGACT Stem DN36954 c0 g2 qRT-PCR Primer
DN36954_c0_g2-R CATCATTCCTTTCCAAGCACC Stem DN36954 c0 g2 qRT-PCR Primer
DN41993_c0_g1-F CTACGACGCACTTGCCTCTGT Leaf DN41993 c0 g1 qRT-PCR Primer
DN41993_c0_g1-R GGGCAAACTGAAGAGGCACAT Leaf DN41993 c0 g1 qRT-PCR Primer
DN30310_c0_g3-F TAGTTTCCGTTTGGGTATGCG Leaf DN30310 c0 g3 qRT-PCR Primer
DN30310_c0_g3-R TTGTGCTCAGCCTGGAATACG Leaf DN30310 c0 g3 qRT-PCR Primer
DN44211_c1_g3-F ATGAAGTATGGCGGCTGGAAA Leaf DN44211 c1 g3 qRT-PCR Primer
DN44211_c1_g3-R TGTTCTACGGTAAACTCCCACATC Leaf DN44211 c1 g3 qRT-PCR Primer
DN26309_c0_g1-F CGTCGGGAATGATTGGAGTTT Leaf DN26309 c0 g1 qRT-PCR Primer
DN26309_c0_g1-R TCTTCTTTCAGCCCGTAATCG Leaf DN26309 c0 g1 qRT-PCR Primer
DN42843_c0_g4-F TTTGAGTGATAAGATGCCGTTCC Leaf DN42843 c0 g4 qRT-PCR Primer
DN42843_c0_g4-R TCCAGAGTGGTTCCGAGTAGGT Leaf DN42843 c0 g4 qRT-PCR Primer
DN29906_c1_g1-F GCCGCTGCTGGTTCCATTTA Fruit DN29906 c1 g1 qRT-PCR Primer
DN29906_c1_g1-R GTTGCCAAATGCCCAATACCC Fruit DN29906 c1 g1 qRT-PCR Primer
DN30439_c2_g2-F GTGACCCTCCAAACCTCCATT Fruit DN30439 c2 g2 qRT-PCR Primer
DN30439_c2_g2-R GGCAGTTCTTGAGCCCTTGAT Fruit DN30439 c2 g2 qRT-PCR Primer
DN44638_c1_g4-F CGTCTCCTCAACTGCCCTCTT Fruit DN44638 c1 g4 qRT-PCR Primer
DN44638_c1_g4-R CTCCAGCAATGGCACATCTTT Fruit DN44638 c1 g4 qRT-PCR Primer
DN21435_c0_g1-F CTTGACACCGAGGCTGCTTAT Fruit DN21435 c0 g1 qRT-PCR Primer
DN21435_c0_g1-R TTGATGACCTGAAACGCCACA Fruit DN21435 c0 g1 qRT-PCR Primer
DN43035_c0_g1-F TTTGAATAAGGGTGATTTGAGTGTC Fruit DN43035 c0 g1 qRT-PCR Primer
DN43035_c0_g1-R TTCAACAACGAAGCCAATACAA Fruit DN43035 c0 g1 qRT-PCR Primer
GAPDH-F CATCCACTCTATCACCGCAACAC Reference gene qRT-PCR Primer
GAPDH-R GCAGGCAACACCTTACCAACAG Reference gene qRT-PCR Primer