Skip to main content

Table 4 Haplotype analysis of the important loci

From: Genome-wide association study of yield and related traits in common wheat under salt-stress conditions

Locus Traits No. of SNPs No. of haplotypes Sequence of alleles Frequency (%) Traits 15LS
Mean ± S.D
16LS
Mean ± S.D
17LS
Mean ± S.D
15HS
Mean ± S.D
16HS
Mean ± S.D
17HS
Mean ± S.D
QSl-1B SL 11 2 TCTCATCCCCT** 33.51 SL 9.65 ± 0.99 7.77 ± 1.01 8.54 ± 0.85 8.57 ± 1.17 7.31 ± 1.24 8.89 ± 0.98
    CTCTGAGATTC 52.88 SL 8.95 ± 1.09 7.05 ± 0.96 7.87 ± 0.67 7.79 ± 1.01 6.71 ± 1.02 8.20 ± 0.90
QYpp-3A YPP 6 3 CCAATG** 5.24 YPP 26.56 ± 4.85 22.57 ± 5.17 24.84 ± 3.63 14.36 ± 1.94 19.37 ± 3.89 23.21 ± 5.17
    ATAATG 77.49 YPP 19.33 ± 6.49 18.74 ± 5.24 19.25 ± 4.20 10.43 ± 3.67 12.96 ± 5.45 16.61 ± 4.95
    ATGGGA 4.71 YPP 17.65 ± 7.75 16.13 ± 5.59 18.31 ± 4.84 9.22 ± 4.24 10.02 ± 5.51 17.60 ± 4.04
QSl-3B SL 5 2 CAGTT** 30.37 SL 9.38 ± 1.50 7.70 ± 1.02 8.36 ± 1.48
    TGTCA 65.97 SL 8.84 ± 1.77 7.16 ± 0.91 7.60 ± 1.75
QTkw-4A TKW 25 2 CCGCCCGGGCGTGCGCGCTGGATCC** 8.90 TKW 52.36 ± 5.43 46.03 ± 4.75 49.14 ± 5.77 40.20 ± 4.80
    TTATTGATATACCTATATCCTGAGT 83.77 TKW 47.92 ± 6.02 40.92 ± 4.79 43.60 ± 9.83 37.65 ± 4.99
QPh-4D PH 4 2 GCTG** 68.06 PH 78.14 ± 20.67 77.55 ± 13.49 82.70 ± 14.71 63.40 ± 17.55 58.83 ± 15.80 73.26 ± 12.67
    TTCA 28.27 PH 67.92 ± 6.00 65.98 ± 5.81 69.37 ± 6.02 57.58 ± 4.86 53.96 ± 6.53 60.63 ± 6.47
Q-5A2 BM YPP 4 2 GACC** 58.64 BM 22.84 ± 6.53
    AGAT 37.17 BM 19.93 ± 8.86
    GACC** 58.64 YPP 11.35 ± 3.11
    AGAT 37.17 YPP 9.73 ± 4.30
Q-5B1 SL BM GN YPP 4 2 AGCA** 88.48 BM 22.46 ± 8.29 26.54 ± 10.51
    GTTG 4.71 BM 15.55 ± 5.51 9.04 ± 6.53
    AGCA** 88.48 SL 6.94 ± 1.22
    GTTG 4.71 SL 5.45 ± 2.54
    AGCA** 88.48 YPP 19.28 ± 5.59 11.11 ± 3.93 13.88 ± 5.48
    GTTG 4.71 YPP 15.33 ± 4.65 7.30 ± 2.45 4.51 ± 3.67
QSl-5B2 SL 21 2 CTTTTAGCGACCGGGCGGCCC** 85.86 SL 6.89 ± 1.35
    TCCCCGAGAGTAAAAAATGTA 4.71 SL 4.58 ± 2.88
Q-5B3 SN BM YPP GN 36 2 GCCCCCTGGCTCCGCCACGCCGGGGGCGTCGTGGCG** 54.45 BM 49.02 ± 16.02 23.90 ± 8.11
    TAAGGTCAATCATATTGTATTAATAAAACTTCCATT 12.57 BM 35.86 ± 15.96 18.35 ± 8.87
    GCCCCCTGGCTCCGCCACGCCGGGGGCGTCGTGGCG** 54.45 GN 627.45 ± 194.97 415.44 ± 107.02 301.59 ± 113.55 310.88 ± 116.97
    TAAGGTCAATCATATTGTATTAATAAAACTTCCATT 12.57 GN 448.46 ± 203.83 361.03 ± 132.06 221.08 ± 105.19 255.05 ± 144.92
    GCCCCCTGGCTCCGCCACGCCGGGGGCGTCGTGGCG** 54.45 SN 15.43 ± 4.51 10.69 ± 2.34 6.75 ± 2.32
    TAAGGTCAATCATATTGTATTAATAAAACTTCCATT 12.57 SN 11.31 ± 5.38 9.43 ± 3.04 5.33 ± 2.46
    GCCCCCTGGCTCCGCCACGCCGGGGGCGTCGTGGCG** 54.45 YPP 21.65 ± 6.80 11.78 ± 3.73
    TAAGGTCAATCATATTGTATTAATAAAACTTCCATT 12.57 YPP 16.43 ± 7.39 9.17 ± 4.39
Q-7A SL YPP 12 2 CGTTACGACCCT** 90.58 SL 7.39 ± 1.02 8.18 ± 0.90 8.49 ± 1.12
    TTACGTAGATAA 5.24 SL 6.77 ± 0.87 7.28 ± 1.31 7.76 ± 1.42
    CGTTACGACCCT** 90.58 YPP 23.71 ± 6.62
    TTACGTAGATAA 5.24 YPP 19.08 ± 8.93
  1. PH plant height, SN spike number, SL spike length, GN grain number, TKW thousand kernels weight, YPP yield per plot, BM biological mass, LS low salinity treatment, HS high salinity treatment, S. D standard deviation
  2. ** represents the favorable haplotype
  3. “--” represents no significantly difference between haplotypes