Skip to main content

Table 1 List of qPCR primers

From: Prior exposure of Arabidopsis seedlings to mechanical stress heightens jasmonic acid-mediated defense against necrotrophic pathogens

Primer name Function   Primer sequence (5′-3′) Locus
PR1 Induced by SA F TGCAGTGGGACGAGAGGGT AT2G14610
R CCACATGTTCACGGCGGAGA
RBOHD Response to ROS F GGTTTCAACGCCTTTTGGTA AT5G47910
R CGGTTTGATGCTTGATCTGA
PDF1.2 ET/JA response F GTTGCATGATCCATGTTTGG At5g44420
R CACCCTTATCTTCGCTGCTC
ACTIN 2 Reference gene F TGTCGCCATCCAAGCTGTTCTCTCC AT3G18780
R ACGTCCAGCAAGGTCAAGACGGAGG
GSL6 Callose deposition F CAAACCATGACGCTCCATAA AT1G05570
R GGTTCGTGGTATCACCCTTG
PRX71 Stem lignification F TTGTTGAACGGCAACGGAGTCACG AT5G64120
R AGCCGCTCGTGACACAGTCATTCT
OPR3 JA pathway F ACGTGGGAACCATCGGGCAACAAA At2g06050
R AGCAAGTTGTGGAAGCAGTTCACGC
VSP1 JA signalling F GGATCGAAGTTGACGCAAGTG AT5G24780
R CTCAACCAAATCAGCCCATTG
PAD3 Camalexin biosynthesis F TTCCTCTGTTTCCTCGTCCT AT3G26830
R ATGATGGGAAGCTTCTTTGG
GST1 Glutathione binding F TAATAAAAGTGGCGATGACC AT1G02930
R ACATTCAAATCAAACACTCG
TCH3 Calcium signalling F AGCCTTCCGCGTATTCGACAAGA AT2G41100
R CCGTCACCATCTGCATCCGC
TCH4(XTH22) Cell wall modification F TGTCTCCTTTGCCTTGTGTG AT5G57560
R GAAACTCCGCAGGAACAGTC
ERF2 Response to ET F TGAGGTTAATTCCGGTGAACC AT3G23240
R TCAACTTCCCGTTTTCAGACGA