Skip to main content

Table 2 Target sequences of sgRNAs designed in this study

From: The application of CRISPR/Cas9 in hairy roots to explore the functions of AhNFR1 and AhNFR5 genes during peanut nodulation

sgRNAs Target sequence (5′-3′) Targeted genes Constructs (plasmid:sgRNAs)
NFR1AB1 TCTAGCTTCCTACTACATG AhNFR1A2 and AhNFR1B2 p201G/Cas9:NFR1AB1 + NFR1AB2
NFR1AB2 TTACCGTTAACTGCTCCTG
NFR5AB1 GCAAGTAACATAAAGAATG AhNFR5A and AhNFR5B p201G/Cas9:NFR5AB1 + NFR5AB2
NFR5AB2 CTTGGGGGCACAGTTTACA
NFR5B ACTCAACCCGAGCCTTCACA AhNFR5B p201G/Cas9:NFR5B