Skip to main content

Table 4 Characterization and polymorphism levels of nine microsatellite loci in P. vietnamensis

From: De novo assembly and Transcriptome characterization of an endemic species of Vietnam, Panax vietnamensis Ha et Grushv., including the development of EST-SSR markers for population genetics

Primers Primer sequence (5′–3′) Repeat motif Fragment size (bp) Ta (°C) A PIC Ho He F GenBank accession no
L37 F: GAGCGGGAGGGAGAGAGA
R: CTTTCTCGTCGTCGTCATCA
(CATCAC)7 120–180 55 4 0.354 0.629 0.650 0.033 MK802095
L39 F: TTTGCCTCACTCCCCTGTAG
R: AGAAGGAGGAGAGACCGAGG
(AGCGGC)5 176–201 55 3 0.332 0.439 0.511 0.146 MK802096
L73 F: TCTTGGGGATTGTGAAGGAG
R: TTAAGGAACAGTGGCAGCAG
(TCTA)8 205–225 55 3 0.394 0.178 0.208 0.146 MK802097
L111 F: GCTCCACAACTCACTCCTCC
R: TCTGTTCAGCTTCGTCCTCC
(TTC)11 197–230 55 4 0.325 0.723 0.610 −0.185 MK802098
L115 F: CCCCATCATTCCATTGGTAG
R: CTCAATCCCATCACGAGGAC
(TGT)10 221–239 55 3 0.442 0.386 0.628 0.386 MK802099
L119 F: CGTGTGTTACTGTTGTGGGG
R: CGATTCTCACTCCCACCATT
(TGA)10 148–166 55 2 0.471 0.429 0.439 0.024 MK802100
L139 F: AATCATGTGGGACCGAAGAG
R: TTGCATTTGGTTTTCTGTGC
(GAA)18 198–249 55 3 0.442 0.217 0.366 0.408 MK802101
L145 F: CCGTCTCCTTCAACTGCTTC
R: AGTTGGGAATGAAGATTGCG
(CTT)15 247–265 55 2 0.493 0.231 0.371 0.379 MK802102
L149 F: CCTCCCCAAATCCTCCTCTA
R: GACCTCTCCAGCTCCAACAG
(CTC)10 164–221 55 3 0.369 0.569 0.529 0.076 MK802103
  1. Note: The number of alleles per locus (A), Observed heterozygosities (HO), expected heterozygosities (HE), the fixation index (F)