Skip to main content

Table 6 Description of the molecular markers applied in the study for the identification of the allelic state of Rht, VRN and Ppd genes

From: Effects of Rht17 in combination with Vrn-B1 and Ppd-D1 alleles on agronomic traits in wheat in black earth and non-black earth regions

Gene Primer sequence Allele Expected size of the product, bp Reference
Rht-B1 Rht-B1p-WF:
5′ ACATGGCGGACGTGGTGC 3′
Rht-B1-R1:
5′ GCCGAGAGAGGACGAT 3’
Rht-B1a 425 [7, 66]
Rht-B1p-F:
5’ ACATGGCGGACGTGGTGT 3′
Rht-B1-R1:
5′ GCCGAGAGAGGACGAT 3’
Rht-B1pa
(Rht17)
425
BF:
5’ GGTAGGGAGGCGAGAGGCGAG 3′
WR1:
CATCCCCATGGCCATCTCGAGCTG
Rht-B1a 237 [67]
BF:
5′ GGTAGGGAGGCGAGAGGCGAG 3′
MR1:
5′ CATCCCCATGGCCATCTCGAGCTA 3′
Rht-B1ba
(Rht1)
237
BF:
5′ GGTAGGGAGGCGAGAGGCGAG 3′
W3:
5′ GGCCATCTCCAGCTGCTCCAGCTT 3’
Rht-B1a 228 [66]
BF:
5’ GGTAGGGAGGCGAGAGGCGAG 3′
M3:
5′ GGCCATCTCCAGCTGCTCCAGCTA 3’
Rht-B1ea
(Rht11)
228
Rht-D1 DF2:
5’- GGCAAGCAAAAGCTTCGCG −3′
WR2:
5’- GGCCATCTCGAGCTGCAC −3’
Rht-D1a 264 [67]
DF:
5’- CGCGCAATTATTGGCCAGAGATAG − 3′
MR2:
5’- CCCCATGGCCATCTCGAGCTGCTA − 3’
Rht-D1ba
(Rht2)
254
Ppd-D1 Ppd-D1_F:
ACGCCTCCCACTACACTG
Ppd-D1_R2:
CACTGGTGGTAGCTGAGATT
Ppd-D1_R1:
GTTGGTTCAAACAGAGAGC
Ppd-D1a 288 [68]
Ppd-D1ba 414
VRN-A1 VRN1AF:
GAAAGGAAAAATTCTGCTCG
VRN1-INT1R:
GCAGGAAATCGAAATCGAAG
Vrn-A1a 965 + 876 [69, 70]
Vrn-A1b 714
VRN1AF:
GAAAGGAAAAATTCTGCTCG
VRN1-INT1R:
GCAGGAAATCGAAATCGAAG
vrn-A1a 734
VRN-B1 Intr1/B/F:
CAAGTGGAACGGTTAGGACA
Intr1/B/R3:
CTCATGCCAAAAATTGAAGATGA
Vrn-B1a 709 [70]
Intr1:
ATCATCTTCTCCACCAAGGG
Intr1/B/R3:
CTCATGCCAAAAATTGAAGATGA
Vrn-B1a
Vrn-B1c
1124
737
[71]
Intr1/B/F:
CAAGTGGAACGGTTAGGACA
Intr1/B/R4:
CAAATGAAAAGGAATGAGAGCA
vrn-B1a 1149  
VRN-D1 Intr1/D/F:
GTTGTCTGCCTCATCAAATCC
Intr1/D/R3:
GGTCACTGGTGGTCTGTGC
Vrn-D1 1671 [70]
Intr1/D/F:
GTTGTCTGCCTCATCAAATCC
Intr1/D/R4:
AAATGAAAAGGAACGAGAGCG
vrn-D1a 997
Rht-8 WMS261-F:
5’- CTCCCTGTACGCCTAAGGC −3′
WMS261-R:
5’- CTCGCGCTACTAGCCATTG − 3′
Rht-8c 192 [72]
  1. arecessive (or partially recessive) allele