Skip to main content

Table 1 Occurrence of lacO-related sequences in the rice genome

From: A modular steroid-inducible gene expression system for use in rice

lacI wild type binding sites number of hits in the rice genome (putative promoters)
exact matches 3 mismatches 4 mismatches 5 mismatches
lacO1 AATTGTGAGCGGATAACAATT 1 4 111 (4) 1144 (43)
lacO2 AAATGTGAGCGAGTAACAACC 0 6 (1) 88 (3) 709 (35)
lacO3 GGCAGTGAGCGCAACGCAATT 1 3 53 (3) 436 (38)
  1. The three E. coli lacO sequences were used to query the rice genome, with criteria set to return all hits with a maximum five mismatches (all of which are predicted to bind lacI – based on binding studies in tobacco ([22])