Skip to main content

Table 2 Selected genes for transcript profiling based on biological function and expression profiles of corresponding proteins

From: Comparative proteomics and gene expression analyses revealed responsive proteins and mechanisms for salt tolerance in chickpea genotypes

Gene Biological function Spot no. /cluster Primer sequence (5′ – 3′) PCR product size (bp) GeneBank accession no.
Actin Reference gene F:TGTTCCCCGGAATTGCTGATAGAATGAGC
R:TTGGAAAGTGCTGAGAGATGCCAAAATGGAG
146 AJ012685
Carbonic anhydrase Photosynthesis 45 / 4 F: TTGAAGTGAAGGAAACC
R: AGAAGAAATGGGAAAGG
195 LOC101498889
Glycerate dehydrogenase Amino acid & nitrogen metabolism 39 / 3 F: GAAAGACTCGCCAAGA
R: GGGCTCATCCTCAAAC
141 LOC101496862
Heat shock 70 kDa protein Stress responsive 4 / 3 F: CTTGATGTAACGCCACTT
R: GTCCACCAGATGACCTAATA
346 LOC101502051
L-ascorbate peroxidase Stress responsive 55 / 5 F: AAATCTTACCCAACCGTCA
R: CAACAACACCACCCAACT
304 LOC101497640
ATP-dependent zinc metalloprotease FTSH2 Protein synthesis and degradation 2 / 4 F: AAAGAACAACCGTGAAGCAA
R: CGGCGACTGGTAATGGA
152 LOC101512859
6-phosphogluconate dehydrogenase Other metabolisms: PP 15 / 4 F: TGACAGCAAGGCAAACAACTC
R: CAGGCATACGACAGAAACCC
112 LOC101509898