Skip to main content

Table 2 Novel SSR markers developed in this study from apple contigs

From: Identification of candidate genes responsible for the susceptibility of apple (Malus × domestica Borkh.) to Alternaria blotch

Marker Primer sequence (5′ → 3′) Origin of apple contig Contig start position (bp) SSR start position in contig (bp) Motif type Copy number
Mdo.chr11.33 m F: GTTCGATCGGGGTGAAAGT
R: CCCCATCCATTTACCCTACC
MDC021160.220 3,150,224 6672 GA 15.5
3_34–12 F: CCAATTGAAGACCTCCCAAA
R: CCAGGAAAAGGACGCTACTG
MDC004702.449 3,152,413 4269 TAA 5.7
3_34–18 F: GAATCCCGAACTGAACCAAA
R: GCTAAAATTTGGGCTTTAGGC
MDC001844.206 3,160,267 223 AT 13