Skip to main content

Table 3 Primers used in the qRT-PCR analysis

From: Grafting alleviates potassium stress and improves growth in tobacco

Gene Accession Number Forward primer (5′-3′) Reverse primer (5′-3′)
HAK1 DQ841950 ATCCACACCGAGCTTGTTTCAGGA TGGGTCCAATTCTTCCCACCAAGA
NKT1 AB196790 TTGCTGGTGATGGTACTTCAG TACCCGCCCTAGATTAGTCG
NHA1 AY383599 GGAAGTTCGACTTCTCGCCA CACAGCTAGCCCTTGTTCTT
NVP1 X83730 GGCACGTAACCACAGTGAAG AGAAGCAGCCATGCCTAGTC
Actina AB158612 AACAGTTTGGTTGGAGTTCTGG CATGAAGATTAAAGGCGGAGTG
  1. areference gene (Act) for qRT-PCR analysis