Skip to main content

Table 2 The microRNAs regulating rapeseed PEPC gene (BnaA03g33640D) and soybean LPAAT2 gene (Glyma.03G139700)

From: An integrated omics analysis reveals molecular mechanisms that are associated with differences in seed oil content between Glycine max and Brassica napus

miRNA_Acc. Target_Acc. Expectation UPE miRNA_start miRNA_end Target_start Target_end miRNA_aligned_fragment Target_aligned_fragment Inhibition
bna-miR169a BnaA03g33640D 4 21.988 1 20 204 223 CAGCCAAGGAUGACUUGCCG AGGCAAGCCAAACUUGGCUG Translation
bna-miR169b BnaA03g33640D 4 21.988 1 20 204 223 CAGCCAAGGAUGACUUGCCG AGGCAAGCCAAACUUGGCUG Translation
bna-miR169c BnaA03g33640D 3.5 21.988 1 20 204 223 UAGCCAAGGAUGACUUGCCU AGGCAAGCCAAACUUGGCUG Translation
bna-miR169d BnaA03g33640D 3.5 21.988 1 20 204 223 UAGCCAAGGAUGACUUGCCU AGGCAAGCCAAACUUGGCUG Translation
bna-miR169e BnaA03g33640D 3.5 21.988 1 20 204 223 UAGCCAAGGAUGACUUGCCU AGGCAAGCCAAACUUGGCUG Translation
bna-miR169f BnaA03g33640D 3.5 21.988 1 20 204 223 UAGCCAAGGAUGACUUGCCU AGGCAAGCCAAACUUGGCUG Translation
bna-miR169g BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169h BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169i BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169j BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169k BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169l BnaA03g33640D 3.5 21.988 1 22 202 223 UAGCCAAGGAUGACUUGCCUGC GAAGGCAAGCCAAACUUGGCUG Translation
bna-miR169n BnaA03g33640D 4 21.988 1 20 204 223 CAGCCAAGGAUGACUUGCCG AGGCAAGCCAAACUUGGCUG Translation
gma-miR171b-3p Glyma.03G139700 3 24.213 1 20 168 186 CGAGCCGAAUCAAUAUCACU AGUGAUAUUGAUU-GGCUUG Cleavage
gma-miR1516a-5p Glyma.03G139700 3 24.131 1 23 283 305 CAAGUUAUAAGCUCUUUUGAGAG CUCUCAAAAGCACUUAUGGCUUG Cleavage
gma-miR1516b Glyma.03G139700 1 14.793 1 21 264 284 AGCUUCUCUACAGAAAAUAUA UAUAUUUUCAGUAGAGAAGCU Cleavage
gma-miR5775 Glyma.03G139700 3 23.458 1 21 279 299 AUAAGCUCUUUUGAGAGCUUC GAAGCUCUCAAAAGCACUUAU Cleavage
gma-miR171b-3p Glyma.19G142500 3 22.553 1 20 210 228 CGAGCCGAAUCAAUAUCACU AGUGAUAUUGAUU-GGCUUG Cleavage