Fig. 3From: Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screeningSequence comparison of SiCL1 alleles in sesame. a: Gene structure comparison of SiCL1 and Sicl1. In the second exon, 20 nucleic acids (CAGGTAGCTATGTATATGCA, 1131–1150 bp in SiCL1) are mutated into 6 nucleic acids (TCTTTG, 1131–1136 bp in Sicl1). Blue line refers to SiCL1 gene. Red line refers to Sicl1 gene. Green vertical line indicates a splicing site. b: cDNA sequence alignment of SiCL1–1, SiCL1–2 and Sicl1 alleles and the corresponding amino acids. The dots after the red letter ‘A’ in Sicl1 gene sequences refer to the spliced fragment. The red letters in Sicl1 protein sequence refer the new amino acids formed by the frameshift mutation. The red asterisk refers to the terminator. The blocked sequences in SiCL1–1 and SiCL1–2 refer to a splicing siteBack to article page