Skip to main content

Table 1 Primer sequences for the three genes used in RT-PCR

From: Salicylic acid reverses pollen abortion of rice caused by heat stress

Gene MSU_Locus Forward (5′-3′) Reverse (5′-3′)
EAT1 LOC_Os04g51070 AAGGCCAACTCTCTGCTTCATG AAACCGCCGAACCTTCTGATAC
MIL2 LOC_Os12g28750 GCCTCGTCATCCACCAGAAG GACCTGTGTCGTCGTTGGAG
DTM1 LOC_Os07g43010 CGAAACGTCTAATGGGGATTGGG GCTACTGAGATCAAGGGGAGGA
UBQ5 LOC_Os01g22490 GACTACAACATCCAGAAGGAGTC TCATCTAATAACCAGTTCGATTTC
  1. EAT1, Eternal Tapetum 1. MIL2, Microsporeless 2. DTM1, Defective Tapetum and Meiocytese 1. UBQ5 was used as reference gene