Skip to main content

Table 1 The sequences of primers in the construction

From: Ectopically expressing MdPIP1;3, an aquaporin gene, increased fruit size and enhanced drought tolerance of transgenic tomatoes

The name of primer The sequences of primer
MdPIP1;3-F 5’-GGATCCATGGAGGGCAAGGAAGAAG-3’
MdPIP1;3-R 5’-TCTAGATTAGCTCCTGGACTTGAAAGG-3’
MdPIP1;3-GFP-F 5’-GAATTCATGGAGGGCAAGGAAGAAG-3’
MdPIP1;3-GFP-R 5’-GGATCCGCTCCTGGACTTGAAAGGAA-3’
MdPIP1;3-RT-F 5’-TGATGCCAAGAGGAATGCC-3’
MdPIP1;3-RT-R 5’-CACGCTTGGGATGACCACT-3’
MdActin-F 5’-CAATGTGCCTGCCATGTATG-3’
MdActin-R 5’-CCAGCAGCTTCCATTCCAAT-3’
SlActin-F 5’-CCACGAGACCACATACAACT-3’
SlActin-R 5’-TGAGGGAAGCCAAGATAGAG-3’
SlPIP1;2-RT-F TTTCACTCACTAACTCCCATCAAT
SlPIP1;2-RT-R TAAAGAAAGAGGAAAGTAGCCACA
SlPIP1;3-RT-F ACCATCAAATAATCATCAGAGCA
SlPIP1;3-RT-R AGGATAAAATAAAAATTATTTTCAT
SlPIP1;5-RT-F ATGATTATGCCAAGGGAGATGA
SlPIP1;5-RT-R GCCAAATGAACCAAGAACACAG
SlPIP2;1-RT-F ACGTACCCGTGTTGGCACCTCTTCC
SlPIP2;1-RT-R ATGTTCGTCCCACGCCTTGTCACC
SlPIP2;5-RT-F GTCCTCTTCCAGCCATCCA
SlPIP2;5-RT-R ACCACTGAGCACAATGTTACCG
SlPIP2;7-RT-F ATTCCCATATCCCTGTGTTGGCTCC
SlPIP2;7-RT-R AGCTGCAGCTCTCAAAATGTATTGG