Skip to main content

Table 1 Primer sequences for qRT-PCR

From: Exogenous trehalose improves growth under limiting nitrogen through upregulation of nitrogen metabolism

Annotation AGI Sense (5′ to 3′) Antisense (5′ to 3′)
NtTPS1 FG161474.1 TTCTTGGGGAAGGATGAGGATGTAT CTTCTCCGAGTTCGATACAGGCCTA
NtTPS5 FG157491.1 TTTTGTGAGGCCAAATCATGATGCC GGCGTATTGGTAATTCCAAACAAGC
NtTPS8 FG198612.1 ATTGTCGAAGTCAAACCACAAGGTG AGGTAATACTTGGCTTTGCTTGGCT
NtTPPA FG173116.1 ATGAGAAGAGTTGGTCAGCTATTGG AGAACTCAACAGCTTTCCCCTTGTC
NtTPPB FG143777.1 ACAACAAATTCTGCTTATCCGTACA TGAATTAGCATACCCTAATGATTCC
NtHSP70–1 DV161835 AGGTGGAGACATGGGTGGTG TCATTAGGCACACAGATCTCTG