Skip to main content

Table 2 M. quinquemaculata gene primers used in various experiments

From: Plant-mediated RNAi silences midgut-expressed genes in congeneric lepidopteran insects in nature

No Gene Primer sequences (5′-3′) Use
1 MqUbiquitin For- CAAGAAGCGCAAGAAGAAGAAC Internal control for M. quinquemaculata transcript quantification
Rev- CGTCCACCTTGTAGAACCTAAG
2 MqBG1 For- CCAACCGCCTATGCTGATAAA Transcript quantification and testing the silencing efficiency of M. quinquemaculata BG1
Rev- GTGACCATGGGTTGGATGTT
3 MqBG2 For- GCTGTATGTTACGGCCAAGA Transcript quantification and testing the co-silencing efficiency of M. quinquemaculata BG2
Rev- CACGCGCCTTCTACTTGATA
4 MqCYP6B46 For- GTGCCTATTACTCCGCGATCTA Transcript quantification and testing the silencing efficiency of M. quinquemaculata CYP6B46
Rev- CAAGCCTTCTTTGCTAAACTCC
5 MqCYP6B45 For- GAAATGGATAAATTGGTTTTGACC Transcript quantification and testing the co-silencing efficiency of M. quinquemaculata CYP6B45
Rev- TTATTTTGACAGAGAAGATTGAGG
6 MqUbiquitin For- CGACTACAACATCCAGAAGGAG Amplification of partial coding sequence of M. quinquemaculata Ubiquitin
Rev- GGCTTACGGCTACATCTTAGTC
7 MqBG1 For- GAAGTTGTTGATGCTCGCC Amplification of partial coding sequence of M. quinquemaculata BG1
Rev- GTGACCATGGGTTGGATG
8 MqBG2 For- GCTGTATGTTACGGCCAAG Amplification of partial coding sequence of M. quinquemaculata BG2
Rev- GGCTGAATATTGTATTTAAGC
9 MqCYP6B46 For- TGCCTATTACTCCGCGATCTA Amplification of partial coding sequence of M. quinquemaculata CYP6B46
Rev- TCAATTCGCTTGCGTAGGT
10 MqCYP6B45 For- GATCAAAGATTTCGACGTGTTCAT Amplification of partial coding sequence of M. quinquemaculata CYP6B45
Rev- ACTTTGAGAGGGAAGATTGAAA