Skip to main content

Table 1 Primer sequences used in this study

From: TaFlo2-A1, an ortholog of rice Flo2, is associated with thousand grain weight in bread wheat (Triticum aestivum L.)

Primer name Primer sequence (5′-3′) Position on scaffold sequence Annealing temperature (°C) PCR product size Function
Flo2-1F TGTGCTGGAATCACCCACTC 793–812 60 1061 cloning TaFlo2 /polymorphism detection
Flo2-1R GCGCGGCGAAAACTAATCAT 1853–1844
Flo2-2F GTGCCGTCCATAATCGTTGC 1546–1565 60 1781 cloning TaFlo2 /polymorphism detection
Flo2-2R CATGTGCGGCAAAAGACACA 3326–3307
Flo2-3F AACGGGCATGTGTCTTTTGC 3299–3318 60 3025 cloning TaFlo2 /polymorphism detection
Flo2-3R CGACGCAGCTCTGAAAATCG 6332–6313
Flo2-4F CGCTTAGCAGTGGATTTGCC 5719–5738 60 3948 cloning TaFlo2
Flo2-4R ATCCAACAAACAGGTGCCCA 9667–9647
Flo2-5F TTGCGGAAGCCCATCATTCT 8387–8406 60 3836 cloning TaFlo2
Flo2-5R TGACCTTCTGCGGATGCTTT 1222–12,203
Flo2-6F CAGAACAGGGCCGGTACAAT 11,368–11,387 60 2600 cloning TaFlo2
Flo2-6R CGCTCATCTGGATAGGGCAA 13,967–13,948  
TaFlo2-InDel8F ACCCCTCCTCCGTTATCGTC 1337–1356 60 145/153 8-bp InDel polymorphism in TaFlo2-A1
TaFlo2-InDel8R CCTCCTTCTTCTTGCGGTCG 1470–1489
Flo2-A1F GTGCTCCGATCCGATGTGCAGTTAT 5387–5411 58 587 2A specific
Flo2-A1R GTGCACAACCAAGTAAAAGG 5973–5954
Flo2-B1F GTC ATC ACTAGAGGA ATTTTCC 6851–6872 58 902 2B specific
Flo2-B1R CTCTCAGAACTGTGGAT 7752–7736
Flo2-D1F CTGTATCTGTAATTTGTTCCG 5378–5398 58 326 2D specific
Flo2-D1R CTTCCGAAAAATGTGGGG 5704–5687
mFlo2-1F TAACGGTGGTGCACTTGTGT 58 1868 Cloning mRNA
mFlo2-1R TCAGCCGCAAGTTATGCTCA
mFlo2-2F TGCGGACGAGATGGAAAACA 58 1809 Cloning mRNA
mFlo2-2R AGCAGTCAGCCGATGGTATG
mFlo2-3F ATGCGTACTCCCTAAGCGTG 58 1889 Cloning mRNA
mFlo2-3R CACGAAGTGCTGCTTGCTTT
eTaFlo2F CCATTCGGCTTTCGTGCAAA 55 134 Expression analysis
eTaFlo2R TGTTTTCCATCTCGTCCGCA
ActinF AGCCATACTGTGCCAATC 55 134 Internal control
ActinR GCAGTGGTGGTGAAGGAGTAA
\