Skip to main content

Table 3 Primer sequences

From: Expression and functional analysis of the transcription factor-encoding Gene CsERF004 in cucumber during Pseudoperonospora cubensis and Corynespora cassiicola infection

Primer name Sequence (5′-3′) Used for
CsERF004-F ATGGCTCGTCCACAACAACG Cloning
CsERF004-R TTATGTAATAATTTCGAATGATCCGAG Cloning
qCsERF004-F CAACACGTCCACAAACAACA qRT-PCR
qCsERF004-R TGGAATAGACCCACGTTTCA qRT-PCR
qCsPR1-F TGGTGCACTCCAATGGCTCT qRT-PCR
qCsPR1-R GGGTGTAATGGCGACACTCG qRT-PCR
qCsPR4-F ACTGCTTTCTGTGGCCCAGTT qRT-PCR
qCsPR4-R ACCCTCCGTTGGAGCATTGA qRT-PCR
qCsEF1a-F CCAAGGCAAGGTACGATGAAA qRT-PCR
qCsEF1a-R AGAGATGGGAACGAAGGGGAT qRT-PCR
qCsEF1a-R AGAGATGGGAACGAAGGGGAT qRT-PCR
GFP-CsERF004-F GGATCCATGGCTCGTCCACAACAACG Subcellular localization
GFP-CsERF004-R GGACCCGGGTTGTAATAATTTCGAATGATCC Subcellular localization