Skip to main content

Table 2 Predicted binding site of miR156 and miR157 on sequences of candidate target genes in SPL family

From: Exploring miRNAs involved in blue/UV-A light response in Brassica rapa reveals special regulatory mode during seedling development

Candidate gene Start region number in mRNA sequence mRNA sequence of predicted binding site area Amino acid sequence of corresponding binding site area Stop region number in amino sequence
Bra027478 (SPL2) 922 GAUGGUGCUCUCUCUCUUCUGUCAAAU QDLDGALSLLSNSTAW 316
Bra033671 (SPL2) 841 GAUGGUGCUCUCUCUCUUCUGUCAAAU QDLDGALSLLSNSTPW 293
Bra004363 (SPL6) 631 ACUUGUGCUUGCUCUCUUCUGUCAGCU PRSTCACSLLSAQSQQ 223
Bra038324 (SPL6) 673 ACUUGUGCUCUCUCUCUUCUGUCAGCU PRSTCALSLLSAQSQQ 237
Bra016891 (SPL9) 736 AACUGUGCUCUCUCUCUUCUGUCAAAU GDSNCALSLLSNPHQ 257
Bra004674 (SPL9) 739 AACUGUGCUCUCUCUCUUCUGUCAAAC SVTNCALSLLSNPHQP 259
Bra010949 (SPL10) 991 UACAGUGCUCUCUCUCUUCUGUCAACG QDFYSALSLLSTSSDS 343
Bra030041 (SPL10) 1015 UACAGUGCUCUCUCUCUUCUGUCAACG QDFYSALSLLSTSSDS 351
Bra030040 (SPL11) 1067 CACCGUGCUCUCUCUCUUCUGUCAACU QEFHRALSLLSTSSSD 369
Bra032822 (SPL11) 994 CACCGUGCUUUCUCUCUUCUGUCAACU QDFHRAFSLLSTSSGP 344
Bra022766 (SPL13) 844 GAUUGCGCUCUCUCUCUUCUGUCAUCA HDSDCALSLLSSSSSH 294
Bra003305 (SPL15) 562 AGCUGUGCUCUCUCUCUUCUGUCAAAC TDSSCALSLLSNYTNP 201
Bra014599 (SPL15) 550 AGCUGUGUUCUCUCUCUUCUGUCAAAC TDSSCVLSLLSNSNTT 196