Skip to main content

Table 1 Characterization of eleven microsatellite loci isolated from 218 individuals of Fontainea picrosperma

From: Population genetic analysis of a medicinally significant Australian rainforest tree, Fontainea picrosperma C.T. White (Euphorbiaceae): biogeographic patterns and implications for species domestication and plantation establishment

Locus GenBank Repeat motif Primer sequences (5′–3′) Size range (bp) PIC N A H O H E F IS
FP21
KC759358
(TA)13 F: TCACTGAATTCGCTTGGTTG
R: TGCAAATACCAGAAGTGCCA
194–204 0.596 6 0.532 0.664 0.000
FP32
KC759359
(GT)8 F: CTGGCTTGCATTTGCTTGTA
R: TGCTAAACTTCAAGGGCTTAGG
190–192 0.329 2 0.339 0.416 −0.034
FP39
KC759362
(GA)15 F: CTGCACGACAAGAAAACTCG
R: TGAGTCAATATTGTAAGGGAATTATGA
203–213 0.293 3 0.280 0.325 −0.004
FP40
KC759363
(TG)16 F: TTCTCGTCCTCTACTGGGCT
R: CCCTACCTTTCCCACTCACA
134–152 0.455 6 0.550 0.551 −0.096
FP44
KC759364
(AT)7 F: TGAAGCTAATTGCTTGATCTTCC
R: GGGTATTTATTTTCTTGTTTGTTTCC
112–122 0.390 5 0.459 0.505 −0.117
FP47
KC759365
(TC)7 F: CCTAAAAGTGCCCTTTGGCTA
R: TGTGACTTTCCATGCTCCAG
238–242 0.284 3 0.307 0.338 −0.192
FP49
KM213753
(GA)8 F: TTTATACAACCACCAGTCGCC R: CACCTTCACTGAAATTCTCTTCTTC 171–175 0.479 3 0.468 0.537 0.013
FP56
KM213754
(TA)14 F: CAGGGCTTAGAATCGGGTGT R: TCACATCCTAGGTCCGTTCAC 258–270 0.776 7 0.391 0.806 0.390
FP59
KM213755
(AT)11 F: TCCCTCCTGTTAAGACTGTTACA R: CCTTCACCATCAATCAGCCG 210–218 0.163 2 0.143 0.179 0.128
FP62
KM213756
(TC)11 F: TGAAAATGCTGACCAAATATGTGA R: AGTTTCCCAGGATCCCACAT 271–273 0.375 2 0.468 0.501 −0.086
FP64
KM213757
(GAC)11 F: ACGGTGAAGACGATGATGGT R: CGTGTGTTACCTCTTCTTCAGC 108–129 0.581 6 0.385 0.631 0.075
    Mean 0.429 4.1 0.393 0.496 0.007
  1. Samples were collected from the Atherton Tablelands, Australia from seven locations shown in Fig. 1. PIC polymorphic information content; N A number of alleles; H O observed heterozygosity; H E expected heterozygosity; F IS inbreeding coefficient