Skip to main content

Table 1 Primer pairs for the selected genes and the reference gene

From: Expression profiling of genes involved in drought stress and leaf senescence in juvenile barley

  Gene Functional annotation Acc. No. Primer (FOR and REV) Ampl.
Drought stress genes A1 ABA inducible gene GenBank:
X78205.1
ACACGGCGCAGTACACCAAGGAGT
CCCACCACGGCGTTCACCAC
100 bp
Dhn1 Dehydrin 1 GenBank:
AF181451
GCAACAGATCAGCACACTTCCA
GCTGACCCTGGTACTCCATTGT
141 bp
GAD3 Glutamate decarboxylase 3 GenBank:
AY187941
ATGGAGAACTGCCACGAGAA
GGAGATCTCGAACTCGTCGT
147 bp
NADP_ME NADP-dependent malic enzyme-like GenBank:
XM_003569737
ATGGCGGGAAGATCAGGG
ATCCCTCAGCAGGGAATGC
165 bp
P5CS2 Delta 1-pyrroline-5-carboxylate synthase 2 GenBank:
AK249154.1
GTATACATGCACGTGGACCC
CAGAGGGTTTTCGCCGAATC
164 bp
Leaf senescence genes Contig7437 SAG senescence associated gene GenBank:
KF190467.1
GCTGAACGGCTGCCACTCCC
GAAACCATCGCGCCTGTGGTG
78 bp
GSII Glutamine synthetase 2 GenBank:
X53580.1
ACGAGCGGAGGTTGACAG
CGCCCCACACGAATAGAG
94 bp
hv_36467 SAG senescence associated gene GenBank:
AK367894.1
CAGTCCTTTTGCGCAGTTTTC
CCAAGCGAGAATGCCTTGTAA
152 bp
LHC1b20 Light-harvesting complex I GenBank:
S68729.1
CTGACCAAGGCGGGGCTGATGAAC
TCGTGGGGCGGGAGGCTGTAG
200 bp
pHvNF-Y5α SAG senescence associated gene GenBank:
AK370570
CATGAAGCGAGCTCGTGGAACA
GGTGCGAAGGTGGGACTACTCTGA
126 bp
Genes out of GWASa AVP1 Vacuolar proton-inorganic pyrophosphatase GenBank:
AY255181.1
GACCCTCTCAAGGACACCTC
TCCCAACCGGCAAAACTAGA
160 bp
ETFQO Electron transfer flavoprotein-ubiquinone oxidoreductase GenBank:
BT000373.1
CCACAACCCTTTCTTGAATCCG
GATCTAAGGGCGTGGTGAATTT
160 bp
SAPK9 Serine/threonine protein GenBank:
AB125310.1
TCATGCAAGACTGTTTCTTGGG
TTTCTTCTTGGCACAAAGCATATT
149 bp
TRIUR3 Protein kinase  
GenBank:
M94726
ACATTGACGTTGAGAGCAGC
GCTACAGAGAATTTGTGACCCA
151 bp
HvGAPDH Glyceraldehyde-3-phosphate dehydrogenase GenBank:
DQ196027.1
CAATGCTAGCTGCACCACCAACTG
CTAGCAGCCCTTCCACCTCTCCA
165 bp
  1. aGenes coding for proteins identified by BlastX of significant marker sequences out of a previous genome wide association study (GWAS) by Wehner et al. [20]