Skip to main content

Table 4 Primers for qRT-PCR to verify above seven genes involved in catechins biosynthesis in tea plant

From: De novo assembly and transcriptome characterization: novel insights into catechins biosynthesis in Camellia sinensis

Target CDSs Primer Sequence (5′ to 3′)
Tea_T4_Unigene_BMK.28458 (LAR-1) F AAACTCTTCAAGACAAAGGCGCTAA
R TCTATCAATCGCCGCACCCTC
Tea_T4_Unigene_BMK.50436 (LAR-2) F GACTGTAGCAGCAGAAGTAGCC
R TCAATCTTATGGTCCCTCAAA
Tea_T4_Unigene_BMK.41423 (LAR-3) F GCTGTGGGTGGTGCTAAT
R GCGATCCAAAGGAGGAAT
Tea_T4_Unigene_BMK.49588 (ANS-1) F ATGACTACAGTGGCTGCCCCGA
R CAACGCCTCCCGACACCTCTC
Tea_T1_Unigene_BMK.79499 (ANS-2) F ACGAGGGCAAATGGGTCA
R CCTTATTAACGAGTCCACGATG
Tea_T1_Unigene_BMK.72783 (ANR-1) F CTGTCCGAGACCCAGGCAATC
R GGGCGTCAAAGCTCTGTTCAT
Tea_T4_Unigene_BMK.60174 (ANR-2) F CAATGGCAATGGTAACAACA
R TCCAGTGCTACGAGGTGAG
TaGAPDH (internal control gene) F TTGGCATCGTTGAGGGTCT
R CAGTGGGAACACGGAAAGC