Skip to main content

Table 2 Nucleotide sequences of primers specific to cyanidin-based anthocyanin biosynthetic genes and Actin1 gene used for qRT-PCR

From: Transcript profiling of structural genes involved in cyanidin-based anthocyanin biosynthesis between purple and non-purple carrot (Daucus carotaL.) cultivars reveals distinct patterns

Gene Forward primer 5′-3′ Reverse primer 5′-3′
PAL1 ACATTACCCCTTGCTTGCCACT TCAAAGAATCCACCATCAACTCC
PAL3/PAL4 CTGGCATGGCCTCTATGGTACT TGTCCTGGATGGTGCTTCAACT
CA4H1 GTGGAGGCCAACGGAAATG CGTCCGATTGTGATACCGAGA
CA4H2 CCGGCAAAGAGCAAAGTTGT CAGCCCCGAATGGTAGGAAT
4CL1 AAACACCTGCCGTTACACTCG CGGAAGCAAGATCATCATCGTAT
4CL2 AGAGCCAAGTTTCCTAATGCCA TCCCCGTTGATTCCTTGGTAG
CHS1 TTCCACCTTCTCAAAGATGTTCC GCTCAACTCTGTTTCAACTTGGTC
CHS2/CHS9 ATCAGGAAAAGGCAGAGGGC ATCCGCCTGGTAGACGCAGT
CHI1 TCCTGCCACGGTCAAACCT AAGAGCGAGCGACGGAATC
F3H1 GAGTACAGTGAGAAGCTGATGGGTC GGTTGAGGGCACTTGGGATAG
F3′H1 TTGAGGATGGTGAAGGTGGGA CTTTTGGGCGACGCAGAAC
DFR1 GTTATCAAGCCTACCGTACAGGG AGTTCCAGCAGACGAAGTGTAAAT
LDOX1/LDOX2 AGGTGCCCACAGTCGACATAGC CGCCTGTCCAGCCACTCTAA
DcActin1 CGGTATTGTGTTGGACTCTGGTGAT CAGCAAGGTCAAGACGGAGTATGG