Skip to main content

Table 2 qRT-PCR primer sequences designed to amplify products < 200 bp.

From: 'Who's who' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity

Target sequence Primer Sequence Product size [bp]
18S rRNA
[GenBank:AF419797]
Forward: GGGATGAGCGGATGTTACTT
Reverse: CCCTTCCGTCAATTCCTTTA
116
CvAP3
[GenBank:GQ202026]
Forward: TCGACGAGCTGAATAGTCTTGA
Reverse: TCGACTAGCCCATAGTGTGGAT
190
CvSEP1
[GenBank:GQ202027]
forward: AGCATCATCCTCAATCCCAG
Reverse: GATCATTCCGCTCACGTTTT
143